Nutrition Affects Embryo Survival, Progesterone, Leptin, Leptin Receptor, and Progesterone Receptor Membrane Component 1 in Goats

N. H. Mohammed; C. S. Y. Yong; K. H. Ling; N. B. M. Alitheen; G. B. Martin; M.  ShikhMaidin

doi:10.5398/tasj.2026.49.6.492

N. H. Mohammed ⁽¹⁾ , C. S. Y. Yong ⁽¹⁾ , K. H. Ling ⁽²⁾ , N. B. M. Alitheen ⁽³⁾ , G. B. Martin ⁽⁴⁾ , M. ShikhMaidin ⁽¹⁾

(1) Department of Biology, Faculty of Science, Universiti Putra Malaysia, Malaysia,

(2) Department of Biomedical Science, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Malaysia,

(3) Department of Cell and Molecular Biology, Department of Biomedical Science, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Malaysia,

(4) School of Animal Biology, Faculty of Natural and Agricultural Sciences, The University of Western Australia, Australia

https://doi.org/10.5398/tasj.2026.49.6.492

Issue
Vol. 49 No. 6 (2026): Tropical Animal Science Journal (Issue in progress)

Submitted
March 13, 2026

Accepted
June 22, 2026

Published
September 8, 2026

Keywords:

embryo mortality, goat, LEPR, nutrition, PGRMC1

PDF XML

Abstract

Embryo mortality remains a significant limitation on reproductive efficiency in goats, especially in the first month of pregnancy. Given the important role of maternal nutrition in regulating the endocrine and molecular mechanisms required for pregnancy maintenance, this study aimed to determine the effects of short-term concentrate supplementation on circulating leptin, neuropeptide Y (NPY), and progesterone concentrations, LEPR and PGRMC1 expression, and early embryo survival in female Boer goats. Twenty female Boer goats were randomly allocated in a completely randomized design to either a Control group receiving a maintenance diet supplying 4.45 MJ ME/day or a supplemented group receiving additional concentrate to supply 8.90 MJ ME/day, equivalent to twice the maintenance energy requirement. The supplemented diet provided twice the maintenance energy requirement for 25 days, beginning five days before ovulation and extending into early pregnancy. Blood plasma sampled every 2 days, from days -5 to 27, was assayed for leptin, neuropeptide-Y, and progesterone. On day 27 after mating, the expression of PGRMC1 and LEPR was assessed in pituitary tissue, follicles, and corpora lutea (CL). Pregnancy and embryo loss were monitored using progesterone concentration and transrectal ultrasonography. Data were analyzed using independent t-tests, repeated-measures analysis, Spearman correlation, and Chi-square tests. Nutritional supplementation significantly increased the circulating concentrations of leptin, neuropeptide-Y, and progesterone (p<0.05). It also increased the expression of PGRMC1 3.7-fold in luteal tissue and 2.3-fold in follicular tissue, and increased the expression of LEPR 5.0-fold in pituitary tissue and 3.3-fold in luteal tissue. Plasma progesterone concentration was positively correlated with plasma leptin concentration (r = 0.63; p<0.05) and with PGRMC1 expression (r = 0.65; p<0.05). Compared with the Control diet, the supplemented diet increased the pregnancy rate from 55.6% to 87.5% and reduced embryo loss from 44.4% to 10.0% despite having no effect on ovulation rate (1.00 ± 0.21 vs. 1.25 ± 0.24, p>0.05). It was concluded that nutritional supplementation enhances luteal function, progesterone synthesis, and embryo survival, and that the effects were mediated by circulating leptin and improved expression of PGRMC1 and LEPR.

Full text article

Generated from XML file

References

Asgari, R., Caceres-Valdiviezo, M., Wu, S., Hamel, L., Humber, B. E., Agarwal, S. M., Fletcher, P. J., Fulton, S., Hahn, M. K., & Pereira, S. (2025). Regulation of energy balance by leptin as an adiposity signal and modulator of the reward system. Molecular Metabolism, 91, 102078. https://doi.org/10.1016/j.molmet.2024.102078

Asperger, H., Stamm, N., Gierke, B., Pawlak, M., Hofmann, U., Zanger, U. M., Marton, A., Katona, R. L., Buhala, A., Vizler, C., Cieslik, J.-P., Ruckhäberle, E., Niederacher, D., Fehm, T., Neubauer, H., & Ludescher, M. (2020). Progesterone receptor membrane component 1 regulates lipid homeostasis and drives oncogenic signaling resulting in breast cancer progression. Breast Cancer Research, 22, 1–16. https://doi.org/10.1186/s13058-020-01312-8

Astuti, D. A., Khotijah, L., Maidin, M. S., & Nugroho, P. (2020). Reproductive profile of Etawah crossbred does fed flushing diet containing different kinds of plant oil and animal fat. Pakistan Journal of Biological Sciences, 23(5), 650–657. https://doi.org/10.3923/pjbs.2020.650.657

Batista, A. M., Silva, D. M. F., Rêgo, M. J. B. M., Silva, F. L. M., Silva, E. C. B., Beltrão, E. I. C., Gomes Filho, M. A., Wischral, A., & Guerra, M. M. P. (2013). The expression and localization of leptin and its receptor in goat ovarian follicles. Animal Reproduction Science, 141(3-4), 142–147. https://doi.org/10.1016/j.anireprosci.2013.08.007

Bustamante-Andrade, J. A., Meza-Herrera, C. A., Rodríguez-Martínez, R., Santos-Jimenez, Z., Ángel-García, O., Gaytán-Alemán, L. R., Gutierrez-Guzman, U. N., Esquivel-Romo, A., & Véliz-Deras, F. G. (2021). Luteogenesis and embryo implantation are enhanced by exogenous hCG in goats subjected to an out-of-season fixed-time artificial insemination protocol. Biology, 10(5), 429. https://doi.org/10.3390/biology10050429

Celestino, J. J. H., Bruno, J. B., Lima-Verde, I. B., Matos, M. H. T., Saraiva, M. V. A., Chaves, R. N., Martins, F. S., Almeida, A. P., Cunha, R. M. S., Lima, L. F., Khesller, P. O., Campello, C. C., Silva, J. R. V., Báo, S. N., & Figueiredo, J. R. (2010). Steady-state level of kit ligand mRNA in goat ovaries and the role of kit ligand in preantral follicle survival and growth in vitro. Molecular Reproduction and Development, 77(3), 231–240. https://doi.org/10.1002/mrd.21138

Chaudhari, R. K., Mahla, A. S., Singh, S. K., Pawde, A. M., Badasara, S. K., Kumar, H., Patra, M. K., & Krishnaswamy, N. (2020). Effect of dietary n-3 polyunsaturated fatty acid flushing on the expression of genes involved in progesterone biosynthesis in the corpus luteum of goat (Capra hircus). Reproduction in Domestic Animals, 55(9), 1263–1266. https://doi.org/10.1111/rda.13757

Dar, R. R., Firdous, S., Amin, B. Y., Ali, A., Narayanan, K., & Patel, M. (2017). Luteal dysfunction: A potential cause of repeat breeding and the strategies to combat it. Theriogenology Insight, 7(2), 105–112. https://doi.org/10.5958/2277-3371.2017.00026.2

Flores, R., Ramirez, M., Ayala, L., Benavides, E., Xie, F., Arellano, A., Stanko, R., & Garcia, M. (2022). Adiponectin influences FGF2 in the developing porcine corpus luteum. Veterinary Sciences, 9(2), 77. https://doi.org/10.3390/vetsci9020077

Frota, I. M. A., Leitão, C. C. F., Costa, J. J. N., Brito, I. R., van den Hurk, R., & Silva, J. R. V. (2011). Stability of housekeeping genes and expression of locally produced growth factors and hormone receptors in goat preantral follicles. Zygote, 19(1), 71–83. https://doi.org/10.1017/S0967199410000080

Gallelli, M., Bianchi, C., Lombardo, D., Rey, F., Rodriguez, F., Castillo, V., & Miragaya, M. (2019). Leptin and IGF1 receptors in alpaca (Vicugna pacos) ovaries. Animal reproduction science, 200, 96-104. https://doi.org/10.1016/j.anireprosci.2018.12.001.

Garcia, M. R. (2017). Leptin contributes to the development of the corpus luteum. Cell & developmental biology, 6(3), 190. https://doi.org/10.4172/2168-9296.1000190

Köse, A. M., Ürer, E. K., Sarıbay, M. K., Doğruer, G., Karaka, F., Çetin, N. Ç., & Demirezer, H. (2021). The effect of gonadotropin releasing hormone administration on fertility and embryonic loss in goats during the anoestrus period. Acta Scientiae Veterinariae, 49. https://doi.org/10.22456/1679-9216.111167

Leal, D. F., Muro, B. B., Nichi, M., Almond, G. W., Viana, C. H., Vioti, G., Carnevale, R. F., & Garbossa, C. A. (2019). Effects of post-insemination energy content of feed on embryonic survival in pigs: A systematic review. Animal Reproduction Science, 205, 70–77. https://doi.org/10.1016/j.anireprosci.2019.04.005

Lixiang, F., Rongqian, Z., Zhang, K., & Yang, W. (2025). Comparison of the 2-CT method and the 2-ΔΔCT method for real-time qPCR data analysis. Journal of Sichuan University (Medical Sciences), 7. https://doi.org/10.1101/2025.07.16.665089

Lodde, V., Garcia Barros, R., Terzaghi, L., Franciosi, F., & Luciano, A. M. (2022). Insights on the role of PGRMC1 in mitotic and meiotic cell division. Cancers, 14(23), 5755. https://doi.org/10.3390/cancers14235755

Macedo, T., Santos, J., Bezerra, M., Menezes, V., Gouveia, B., Barbosa, L., Lins, T., Monte, A., Barberino, R., Batista, A., Barros, V., Wischral, A., Queiroz, M., Araújo, G., & Matos, M. (2019). Immunolocalization of leptin and its receptor in the sheep ovary and in vitro effect of leptin on follicular development and oocyte maturation. Molecular and Cellular Endocrinology, 495, 110506. https://doi.org/10.1016/j.mce.2019.110506

Manna, P. R., Stetson, C. L., Slominski, A. T., & Pruitt, K. (2016). Role of the steroidogenic acute regulatory protein in health and disease. Endocrine, 51(1), 7–21. https://doi.org/10.1007/s12020-015-0715-6

Martin, G. B. (2022). Frontiers in sheep reproduction – Making use of natural responses to environmental challenges to manage productivity. Animal Reproduction, 19(4), e20220088. https://doi.org/10.1590/1984-3143-AR2022-0088

Martins, K., Haas, C., Rovani, M., Moreira, F., Goetten, A., Ferst, J., Portela, V., Duggavathi, R., Bordignon, V., Gonçalves, P., Gasperin, B., & Lucia, T. (2021). Regulation and function of leptin during ovarian follicular development in cows. Animal reproduction science, 227, 106689. https://doi.org/10.1016/j.anireprosci.2021.106689

McGuire, M. R., Mukhopadhyay, D., Myers, S. L., Mosher, E. P., Brookheart, R. T., Kammers, K., Sehgal, A., Selen, E. S., Wolfgang, M. J., Bumpus, N. N., & Espenshade, P. J. (2021). Progesterone receptor membrane component 1 (PGRMC1) binds and stabilizes cytochromes P450 through a heme-independent mechanism. Journal of Biological Chemistry, 297(5), 101316. https://doi.org/10.1016/j.jbc.2021.101316

Meza-Herrera, C. A., Santamaría-Estrada, C. E., Flores-Hernández, A., Cano-Villegas, O., la Peña, C. G. D., Macías-Cruz, U., Calderón-Leyva, G., Ángel-García, O., Mellado, M., Carrillo-Moreno, D., & Véliz-Deras, G. F. (2019). The Opuntia effect upon the out-of-season embryo implantation rate in goats: Corpus luteal number, corpus luteal diameter and serum progesterone concentrations. Livestock Science, 228, 201–206. https://doi.org/10.1016/j.livsci.2019.09.002

Mlyczyńska, E., Kieżun, M., Kurowska, P., Dawid, M., Pich, K., Respekta, N., Daudon, M., Rytelewska, E., Dobrzyń, K., Kamińska, B., Kamiński, T., Smolińska, N., Dupont, J., & Rak, A. (2022). New aspects of corpus luteum regulation in physiological and pathological conditions: involvement of adipokines and neuropeptides. Cells, 11(6), 957. https://doi.org/10.3390/cells11060957

Mohammed, N. H., ShikhMaidin, M., Yong, C. S. Y., Ling, K. H., & Martin, G. B. (2025). Expression of progesterone receptor membrane component 1 (PGRMC1) in follicular and luteal tissues in goats – Effect of short-term concentrate supplementation. Tropical Animal Science Journal, 48(2), 113–119. https://doi.org/10.5398/tasj.2025.48.2.113

Nakano, Y., Kashino, C., Hasegawa, T., Iwata, N., Soejima, Y., Suyama, A., & Otsuka, F. (2022). Effects of leptin and ghrelin on ovarian steroidogenesis and involvement of BMP action in rat granulosa cells. Journal of the Endocrine Society, 6(Supplement_1), A659. https://doi.org/10.1210/jendso/bvac150.1363

O’Connell, A. R., Hurst, P. R., Davis, G. H., McNatty, K. P., Taylor, S. L., & Juengel, J. L. (2013). An earlier rise in systemic progesterone and increased progesterone in the uterine vein during early pregnancy are associated with enhanced embryonic survival in the ewe. Theriogenology, 80(3), 269–274. https://doi.org/10.1016/j.theriogenology.2013.04.006

Robertson, S. M., Atkinson, T., Friend, M. A., Allworth, M. B., & Refshauge, G. (2020). Reproductive performance in goats and causes of perinatal mortality: A review. Animal Production Science, 60(14), 1669–1680. https://doi.org/10.1071/AN20161

Samir, H., Karen, A., Ashmawy, T., Abo-Ahmed, M., El-Sayed, M., & Watanabe, G. (2016). Monitoring of embryonic and fetal losses in different breeds of goats using real-time B-mode ultrasonography. Theriogenology, 85(2), 207–215. https://doi.org/10.1016/j.theriogenology.2015.09.039

Shikh Maidin, M., Blackberry, M. A., Milton, J. T. B., Hawken, P. A. R., & Martin, G. B. (2014). Nutritional supplements, leptin, insulin and progesterone in female Australian cashmere goats. APCBEE Procedia, 8, 299–304. https://doi.org/10.1016/j.apcbee.2014.03.044

Solairaja, S., Ramalingam, S., Dunna, N. R., & Venkatabalasubramanian, S. (2022). Progesterone receptor membrane component 1 and its accomplice: Emerging therapeutic targets in lung cancer. Endocrine, Metabolic & Immune Disorders-Drug Targets, 22(6), 601–611. https://doi.org/10.2174/1871530321666211130145542

Stocco, D., & Selvaraj, V. (2017). Yet another scenario in the regulation of the steroidogenic acute regulatory (STAR) protein gene. Endocrinology, 158(2), 235–238. https://doi.org/10.1210/en.2016-1874

Sueldo, C., Liu, X., & Peluso, J. J. (2015). Progestin and AdipoQ receptor 7, progesterone membrane receptor component 1 (PGRMC1), and PGRMC2 and their role in regulating progesterone’s ability to suppress human granulosa/luteal cells from entering into the cell cycle1. Biology of Reproduction, 93(3), 1-11. https://doi.org/10.1095/biolreprod.115.131508

Takle, Z. J., & Legesse, T. G. (2017). The effect of leptin on the hypothalamic-pituitary gonadal axis and puberty. International Journal of Health Sciences and Research, 7(5), 332–344. https://www.ijhsr.org/IJHSR_Vol.7_Issue.5_May2017/50.pdf

Urata, Y., Salehi, R., Lima, P. D. A., Osuga, Y., & Tsang, B. K. (2020). Neuropeptide Y regulates proliferation and apoptosis in granulosa cells in a follicular stage-dependent manner. Journal of Ovarian Research, 13, 5. https://doi.org/10.1186/s13048-019-0608-z

Urata, Y., Salehi, R., Wyse, B. A., Jahangiri, S., Librach, C., Tzeng, C. R., Osuga, Y., & Tsang, B. K. (2023). Neuropeptide Y directly reduced apoptosis of granulosa cells, and the expression of NPY and its receptors in PCOS subjects. Journal of Ovarian Research, 16, 182. https://doi.org/10.1186/s13048-023-01261-8

Viñoles, C., Sosa, C., Meikle, A., & Abecia, J. A. (2015). Embryo losses during nutritional treatments in animal models: Lessons for humans. In Handbook of Fertility (pp. 99–105). Academic Press. https://doi.org/10.1016/B978-0-12-800872-0.00009-3

Widiyono, I., Yanuartono, P., Purnamaningsih, H., & Sarmin, S. (2022). Influence of refeeding on production, blood biochemistry parameters, and reproduction in underfed Kacang goat does. Journal of Animal Physiology and Animal Nutrition, 107, 453–462. https://doi.org/10.1111/jpn.13753

Wittayarat, M., Kupthammasan, N., Jehdo, H., Jintana, R., Suttikrai, S., Tongkumtae, N., Chutijiratthitkan, N., Khirilak, P., Norsoongnern, S., Kaewma, S., Wattanachant, C., & Panyaboriban, S. (2024). Influence of hormonal treatments on progesterone levels to enhance embryo survival and kidding rates in goats. Animal Bioscience, 38(6), 1140–1149. https://doi.org/10.5713/ab.24.0578

Yuan, X., Yang, C., Wang, X., Zhang, L., Gao, X., & Shi, Z. (2019). Progesterone maintains the status of granulosa cells and slows follicle development partly through PGRMC1. Journal of Cellular Physiology, 234, 709–720. https://doi.org/10.1002/jcp.26869

Zhang, L., Reed, F., & Herzog, H. (2020). Leptin signalling on arcuate NPY neurones controls adiposity independent of energy balance or diet composition. Journal of Neuroendocrinology, 32 (9), e12898. https://doi.org/10.1111/jne.12898

Zhang, W., Peng, J., Wang, N., Shi, Z., Wu, J., & Tong, D. (2025). Expression of leptin and its long-form receptor in the porcine corpus luteum during pregnancy and the protective role of leptin in corpus luteum function in vitro. Theriogenology, 242, 117402. https://doi.org/10.1016/j.theriogenology.2025.117402

Authors

N. H. Mohammed

Department of Biology, Faculty of Science, Universiti Putra Malaysia, Malaysia

C. S. Y. Yong

Department of Biology, Faculty of Science, Universiti Putra Malaysia, Malaysia

K. H. Ling

Department of Biomedical Science, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Malaysia

N. B. M. Alitheen

Department of Cell and Molecular Biology, Department of Biomedical Science, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, Malaysia

G. B. Martin

School of Animal Biology, Faculty of Natural and Agricultural Sciences, The University of Western Australia, Australia

M. ShikhMaidin

Department of Biology, Faculty of Science, Universiti Putra Malaysia, Malaysia

mashitah@upm.edu.my (Primary Contact)

Mohammed, N. H., Yong, C. S. Y., Ling, K. H., Alitheen, N. B. M., Martin, G. B., & ShikhMaidin, M. . (2026). Nutrition Affects Embryo Survival, Progesterone, Leptin, Leptin Receptor, and Progesterone Receptor Membrane Component 1 in Goats. Tropical Animal Science Journal, 49(6), 492. https://doi.org/10.5398/tasj.2026.49.6.492

Download Citation

This work is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License.

Authors submitting manuscripts should understand and agree that copyright of manuscripts of the article shall be assigned/transferred to Tropical Animal Science Journal. The statement to release the copyright to Tropical Animal Science Journal is stated in Form A. This work is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License (CC BY-SA) where Authors and Readers can copy and redistribute the material in any medium or format, as well as remix, transform, and build upon the material for any purpose, but they must give appropriate credit (cite to the article or content), provide a link to the license, and indicate if changes were made. If you remix, transform, or build upon the material, you must distribute your contributions under the same license as the original.

How to Cite

Download Citation

Most read articles by the same author(s)

M. Shikh Maidin, M. H. Padlan, S. A. N. Azuan, R. Jonit, N. H. Mohammed, R. Abdullah, Supplementation of Nigella sativa Oil and Honey Prolong the Survival Rate of Fresh and Post-Thawed Goat Sperms , Tropical Animal Science Journal: Vol. 41 No. 2 (2018): Tropical Animal Science Journal
N. H. Mohammed, M. ShikhMaidin, C. S. Y. Yong, K. H. Ling, G. B. Martin, Expression of Progesterone Receptor Membrane Component 1 (PGRMC1) in Follicular and Luteal Tissues in Goats – Effect of Short-term Concentrate Supplementation , Tropical Animal Science Journal: Vol. 48 No. 2 (2025): Tropical Animal Science Journal

INTRODUCTION

en exceeding 70%–90% depending on management and breed (Samir et al., 2016); (Robertson et al., 2020). However, up to 30% of embryos are lost, mostly before implantation and within the first month of pregnancy, so only 60%–70% of conceptions remain viable by day 30 of gestation (Samir et al., 2016); (Köse et al., 2021). A possible explanation is luteal insufficiency, due to premature luteal regression or luteal dysfunction, so too little progesterone is secreted to support pregnancy (Dar et al., 2017). Over-nutrition has long been linked to an increase in the metabolic clearance of progesterone secreted by the corpus luteum, perhaps decreasing embryo survival (O’Connell et al., 2013) and therefore neutralizing the benefits of improved ovulation rate (Meza-Herrera et al., 2019).

The situation with nutrition is complex because well-timed supplements, often termed ‘flushing’, can improve reproductive outcomes by providing specific metabolic signals during critical stages of the reproductive cycle in goats and sheep (reviews: (Martin, 2022)). Indeed, a supplement can increase the number of embryos in goats (Meza-Herrera et al., 2019); (Astuti et al., 2020). In contrast, poor nutritional management of goats during the peri-conceptional period can impair early embryo survival by creating a sub-optimal environment for oocyte maturation and embryo development (Widiyono et al., 2022). Caloric and protein restriction suppress hypothalamic–pituitary–gonadal (HPG) axis activity by reducing gonadotropin-releasing hormone (GnRH) pulsatility, leading to decreased luteinizing hormone (LH) secretion, impaired follicular development, and suboptimal corpus luteum function. In addition, nutrient deficiency alters metabolic hormone profiles, including reduced leptin and increased neuropeptide-Y (NPY), which further modulate reproductive hormone secretion and ovarian function. Collectively, these endocrine disruptions can impair oocyte competence, fertilization, and early embryo survival.

Luteal structures and progesterone secretion are supported by the hypothalamic-pituitary axis, driven by gonadotropin-releasing hormone (GnRH), so treatment with exogenous GnRH has shown promise in promoting embryonic survival (Köse et al., 2021); (Wittayarat et al., 2024). Evidence is also emerging of a role for progesterone receptor membrane component 1 (PGRMC1), a multifunctional protein localized in granulosa and luteal cells in various species, including goats (Mohammed et al., 2025). The intracellular roles of PGRMC1 include vesicle trafficking, progesterone signaling, mitotic spindle regulation, cell cycle control, and, perhaps most importantly in the context of the present study, steroidogenesis (Solairaja et al., 2022). The synthesis of progesterone involves cholesterol conversion via P450 enzymes, and it is likely that PGRMC1 influences a P450-mediated pathway. However, there is limited information on how nutrition affects PGRMC1 expression and its role in mediating nutritional impacts on progesterone secretion in goats.

Metabolic hormones also play a central role in linking nutritional status with reproductive function. Neuropeptide-Y (NPY), a key regulator of energy balance, can influence reproductive processes both centrally and directly at the ovarian level via its receptors, affecting follicular development and survival (Urata et al., 2023). Leptin, an adiposity signal, is similarly implicated in reproductive regulation, with its receptor (LEPR) expressed in ovarian follicles and the corpus luteum. Leptin has been shown to modulate steroidogenesis and progesterone secretion in other species (Nakano et al., 2022); (Zhang et al., 2025), yet its role in regulating luteal function and early pregnancy in goats remains inadequately characterized.

Despite extensive research on nutritional management and reproductive performance, a critical gap persists in understanding how flushing modulates endocrine–molecular pathways, particularly the interaction between metabolic hormones (leptin, NPY), luteal regulators (PGRMC1), and progesterone secretion during early pregnancy in goats. Therefore, the objectives of this study were to (i) evaluate the effect of nutritional flushing on circulating concentrations of progesterone, leptin, and NPY, (ii) determine the expression of PGRMC1 and LEPR in pituitary and ovarian tissues (follicle and corpus luteum), and (iii) assess the relationships between these endocrine and molecular parameters and reproductive performance in female goats during early pregnancy. We hypothesized that nutritional flushing increases circulating leptin, reduces NPY, upregulates PGRMC1 and LEPR, and thereby improves progesterone secretion and embryo survival.

MATERIALS AND METHODS

Animals and Experimental Design

This study was conducted in accordance with animal ethics guidelines and was approved by the Institutional Animal Care and Use Committee (IACUC) of Universiti Putra Malaysia (Ethics Approval/Registration Number: UPM/IACUC/AUP-R064/2016).

A total of twenty healthy female Boer goats, aged between 2 and 3 years (multiparous), with an average body weight of 27.0 ± 0.9 kg and body condition score (BCS) of 2.3 ± 0.1, were used in this study. The animals were housed individually in pens measuring 1.5 m × 0.5 m and were randomly allocated into two dietary treatment groups: (1) a Control group (n=10) receiving a basal maintenance diet, and (2) a Supplemented group (n=10) receiving the same basal diet with additional commercial goat pellet concentrate to provide twice the maintenance energy requirement.

The synchronization and feeding protocols were performed as previously described by (Mohammed et al., 2025). All animals underwent oestrus synchronization using a controlled internal drug release device (CIDR; Eazi-Breed® CIDR®, Pfizer Australia) containing 0.3 g progesterone, which was inserted intravaginally for 18 consecutive days (Days -18 to 0). The feeding intervention for the Supplemented group began on Day -5 and continued for a total of 25 days (Figure 1). Natural mating was conducted from Days 2 to 4 by introducing fertile bucks to all does. Ovulation rates were assessed on Day 19 using trans-rectal ultrasound, pregnancy and embryo loss were monitored using P4 concentration and trans-rectal ultrasonography on Day 27.

Blood samples for plasma progesterone analysis were collected at two-day intervals from Day -5 to Day 27. Samples were centrifuged post-collection immediately, and the plasma was stored at −20 °C until analysis. On Day 27, all does were humanely sacrificed. Ovaries and brains were harvested immediately; CL tissues were collected from both ovaries, while the anterior pituitary was isolated from the brain. All tissue samples were preserved in RNALater® (Qiagen, USA) and stored at −20 °C for subsequent RNA extraction and quantitative RT-PCR analysis.

Figure 1.Experimental design and sampling schedule for female Boer goats receiving either a maintenance diet or short-term concentrate supplementation supplying twice the maintenance energy requirement

Feeding Treatment

All goats had ad libitum access to clean drinking water throughout the experimental period. The animals were assigned to one of two dietary treatments: the Control group (n = 10), which received a maintenance-level diet supplying 4.45 MJ/day of metabolizable energy (ME), and the Supplemented group (n = 10), which was fed the same basal maintenance diet with additional concentrate supplementation to provide a total of 8.90 MJ/day of ME, equivalent to twice the maintenance energy requirement. The basal diet, offered to both groups, comprised 70% Napier grass (Pennisetum purpureum) and 30% commercial goat pellet concentrate, formulated on a dry matter basis. Feed was provided twice daily at fixed times (morning and afternoon) to ensure consistency in feeding management and intake patterns. Feed refusals were collected and weighed daily to monitor actual feed intake and ensure accurate estimation of nutrient consumption. All feed offered was generally consumed, with minimal refusals observed throughout the experimental period. Out of the 20 animals initially included in the experiment, data from three does (1 Control and 2 Supplemented) were excluded from statistical analysis due to abnormal feeding behavior, resulting in a final dataset used for analysis. The nutritional composition of the feed, including metabolizable energy, crude protein, and dry matter content of Napier grass and the commercial concentrate, is presented in Table 1. The nutrient requirement was calculated according to the nutrient requirements for small ruminants described by the National Research Council (Council, 2007).

Table 1.Nutrient composition of Napier grass and commercial goat pellet concentrate used in the dietary treatments, based on proximate analysesNote: DM = Dry matter; ME = Metabolizable energy; CP = Crude protein.
Type of feed	Nutrient composition
Type of feed	DM (%)	ME (MJ/kg)	CP (%)
Napier grass	25.10	6.47	3.40
Concentrate	89.57	12.35	15.22

Determination of Reproductive Performance

Ovulation rate was evaluated on Day 19 post-breeding by counting the number of corpora lutea (CL) on both ovaries using a 7.5 MHz linear transducer (SSD-900; Aloka, Tokyo, Japan). Pregnancy rate was calculated as the proportion of does confirmed pregnant via transrectal ultrasound on Day 27 and supported by serial plasma progesterone measurements, with levels >2 ng/mL on Day 21 post-breeding indicative of pregnancy. Embryo count and viability were assessed using ultrasound on Day 27, and embryo loss was determined by comparing the number of detected embryos to the expected number based on ovulation data. Additionally, any sudden decline in progesterone concentrations to <2 ng/mL during the experimental period was interpreted as indicative of embryo loss.

Hormone Determination

Plasma concentrations of leptin and NPY were quantified using commercial kits from QayeeBio (Shanghai, China), while progesterone was measured using an ELISA kit from ENZO Life Sciences Inc. (USA), according to the manufacturer’s protocol. The sensitivity of the assays was 15.6 pg/mL for leptin, 6.25 pg/mL for NPY, and 8.57 pg/mL for progesterone. The intra- and inter-assay variations were 5.7% and 6.0% (Leptin), 8.1% and 11.8% (NPY), and 7.9% and 6.2% (progesterone).

Determination of PGRMC1 and LEPR Expression

RNA extraction and cDNA synthesis. Total RNA was extracted from each sample using the RNeasy Mini Kit (Qiagen, USA) following the manufacturer’s instructions. Genomic DNA was removed by on-column DNase digestion using RQ1 RNase-Free DNase (Promega, USA). RNA integrity was confirmed by the presence of clear 28S and 18S rRNA bands on a 1% agarose gel. RNA concentration and purity were measured using a NanoVue™ Plus Spectrophotometer, with all samples showing OD 260/280 ratios between 1.8 and 2.0, indicating good quality. For each sample, 1 µg of total RNA was reverse-transcribed into cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche, USA), and the cDNA was stored at -20 °C until qPCR analysis.

Primers. The design of primers for amplifying the goat LEPR gene was based on gene sequences from multiple species retrieved from the National Center for Biotechnology Information (NCBI) GenBank database. Multiple sequence alignment was performed using ClustalW2 with selected sequences and the full-length LEPR gene to identify conserved exon regions. Primers were designed within these regions using Primer3 software. Primers for PGRMC1 were adopted from (Mohammed et al., 2025), while those for the reference genes GAPDH and β-actin were obtained from (Celestino et al., 2010); the ubiquitin primer was sourced from (Frota et al., 2011). All primer sequences and their corresponding accession numbers are presented in Table 2.

Table 2.Primer sequences used for RT-qPCR analysis of *LEPR*, *PGRMC1*, and reference genes in pituitary, follicular, and luteal tissues of female Boer goatsNote: F= forward primer; R= reverse primer.
Gene	Primer sequence (5′ → 3′)	Amplicon size (bp)	Accession no./ Reference
LEPR	F: TGGCTGGAAGATGTGGGAAA R: TAAAGGGTAAGCACTGAGGGAC	177	XM018045226.1
PGRMC1	F: CCTGAGAGACGGGTAAAACAT R: GTCCCCAAACAGAGAAAGTAGG	297	XM013976238.1
B-actin	F: ACCACTGGCATTGTCATGGACTCT R: TCCTTGATGTCACGGACGATTTCC	200	AF481159/ (Celestino et al., 2010)
GADPH	F: TGTTTGTGATGGGCGTGAACCA R: ATGGCGTGGACAGTGGTCATAA	154	AJ431207/ (Celestino et al., 2010)
Ubiquitin	F: GAAGATGGCCGCACTCTTCTGAT R: ATCCTGGATCTTGGCCTTCACGTT	150	GI:57163956/ (Frota et al., 2011)

Quantitative RT-PCR. The RT-qPCR master mix was prepared using the KAPA SYBR FAST qPCR Kit Master Mix (2X) Universal (KAPA Biosystems, USA), and the reactions were run on a LightCycler 480 system (Roche, USA). Each 20 µL reaction contained 10 µL SYBR master mix, 0.4 µL each of forward and reverse primers (200 nM), 2 µL cDNA (100 ng), and 7.2 µL of nuclease-free water. The cycling program included enzyme activation at 95 °C for 5 min, followed by 40 cycles of denaturation at 94 °C for 15 s, annealing at 60 °C for 30 s, and extension at 72 °C for 45 s. Negative controls, using water instead of cDNA, were included to check for any contamination. Melting curve analysis confirmed specific amplification, and the PCR product size was verified on a 2% agarose gel.

Relative gene expression was calculated using the ^{2^−ΔΔ}Ct method (Lixiang et al., 2025), with the Control group serving as the calibrator. All RT-qPCR reactions were performed in technical triplicate, and mean Ct values were used for downstream analysis to minimize intra-assay variation. Amplification efficiencies of the reference genes were 98.3% for β-actin, 96.9% for GAPDH, and 97.9% for ubiquitin, all within the acceptable MIQE range (90%–110%), supporting their suitability for relative quantification. Normalization was performed using the geometric mean of the three reference genes (GAPDH, β-actin, and ubiquitin) to reduce potential bias associated with single-gene normalization. The expression stability of these genes was assessed across all samples based on Ct consistency, and no significant variation was observed among experimental groups, confirming their stability and appropriateness for normalization.

Statistical Analysis

Statistical analyses were performed using SPSS version 26. The effects of the nutritional supplement on PGRMC1 and LEPR mRNA levels were evaluated using an independent t-test, while plasma progesterone concentrations were analyzed with a repeated-measures multivariate test. Spearman’s rank correlation was used to assess relationships between variables. Ovulation rate, pregnancy rate, and embryo loss rate were compared using the Chi-square test. Quantitative RT-PCR results are presented as fold change ± SD relative to the Control group (set to 1), and plasma progesterone concentrations are shown as mean ± SEM. Statistical significance was set at p≤0.05.

RESULTS

Ovulation Rate, Pregnancy Rate, and Embryo Loss

Nutritional supplementation for 25 days did not significantly affect ovulation rate (1.00 ± 0.21 versus 1.25 ± 0.24 in the Control), indicating that short-term supplementation did not influence follicular recruitment or ovulatory response. However, despite similar ovulation rates, the pregnancy rate was markedly greater in the supplemented group (87.5 ± 0.88%) compared with the Control group (55.5 ± 0.82; p<0.05%). This divergence between ovulation and pregnancy outcomes indicates that the beneficial effects of supplementation were mediated primarily through post-ovulatory mechanisms rather than increased ovulatory output. The improved pregnancy rate was reflected in embryo recovery data. Supplemented does produced significantly more embryos (9.6 ± 0.71) than Control does (5.7 ± 1.42), with embryo loss substantially reduced by supplementation, declining from 44% in Controls to only 10% in supplemented does (Table 3). These findings strongly suggest that nutritional supplementation enhanced embryo survival during early gestation rather than increasing fertilization per se.

Table 3. Ovulation, embryo number, and embryo loss in female Boer goats receiving either a maintenance diet or short-term concentrate supplementation supplying twice the maintenance energy requirementNote: Means in the same column with different superscripts differ significantly (p<0.05).
Group	Number of corpus luteum	Number of embryos			Embryo loss (%)
Group	Number of corpus luteum	0	1	2	Embryo loss (%)
Control (n = 9)	9	4	5	0	44^a
Supplemented (n=8)	10	1	5	2	10^b

Nutritional Supplementation and Concentrations of Leptin, NPY, and Progesterone

Plasma concentrations of leptin, NPY, and progesterone for the Supplemented (flushing) and Control groups are presented in Figure 2. Overall, does receiving supplementation exhibited higher circulating leptin and progesterone concentrations but lower NPY concentrations compared with Controls, reflecting an improved metabolic and endocrine milieu.

From Days -5 to 11, leptin concentrations were similar between groups (Figure 2A). However, from Day 13 to Day 19, leptin levels were significantly greater in supplemented does than in Controls (p<0.05). Although leptin concentrations declined in both groups following cessation of supplementation on Day 19, values remained significantly elevated in the supplemented group through Day 27 (p<0.05). This sustained elevation indicates that the metabolic effects of supplementation persisted beyond the feeding period. The pattern of NPY concentration (Figure 2B) was inverse to that of leptin. Supplemented does consistently exhibited lower NPY concentrations than Controls, although differences were not significant from Days -5 to 9. From Day 11 to Day 19, NPY concentrations were significantly lower in supplemented does, with the greatest divergence observed on Day 19, after which concentrations declined in both groups. Reduced NPY suggests attenuation of the negative energy balance signal and reduced inhibitory input to the reproductive axis. Plasma progesterone concentrations were low and similar between groups until approximately Day 9, after which concentrations gradually increased (Figure 2C). From Day 13 until the end of the sampling period on Day 27, progesterone concentrations were significantly greater in supplemented does than in Controls (p<0.05). Moreover, the result shows that the concentrations of NPY and leptin were significantly negatively correlated (Figure 3A; r = –0.51, p<0.05) and the concentrations of progesterone and leptin were significantly positively correlated (Figure 3B; r = 0.63, p<0.05). The apparent negative relationship between the concentrations of NPY and progesterone was not significant (Figure 3C). The association between elevated leptin, suppressed NPY, and increased progesterone strongly supports the role of improved metabolic status in enhancing luteal function.

Figure 2.Plasma concentrations of (A) leptin, (B) neuropeptide Y, and (C) progesterone in female Boer goats receiving either a maintenance diet (Control; red line; n = 9) or short-term concentrate supplementation supplying twice the maintenance energy requirement (Supplemented; green line; n = 8)

Figure 3.Relationships among plasma concentrations of neuropeptide Y, leptin, and progesterone in female Boer goats receiving either a maintenance diet (Control) or short-term concentrate supplementation supplying twice the maintenance energy requirement (Supplemented)

Expression of LEPR and PGRMC1

Gene expression analysis revealed that the effects of nutritional supplementation extended beyond systemic endocrine changes to include tissue-specific molecular adaptations. Compared with Control does, LEPR expression was significantly upregulated in pituitary (5.03-fold) and luteal (3.32-fold) tissues in supplemented does (Figure 4; p<0.05), with no significant change observed in ovarian follicles. Increased pituitary LEPR expression suggests enhanced central sensitivity to leptin, potentially amplifying its stimulatory effects on gonadotropin secretion. Concurrent upregulation in luteal tissue indicates a direct ovarian action of leptin during the luteal phase. In contrast, PGRMC1 expression in pituitary tissue was unaffected by supplementation (Figure 5), but was significantly increased in follicular (2.31-fold) and luteal (3.75-fold) tissues (p<0.05).

Figure 4.Relative expression of the leptin receptor gene (LEPR) in pituitary, follicular, and luteal tissues collected on Day 27 from female Boer goats receiving either a maintenance diet (Control) or short-term concentrate supplementation supplying twice the maintenance energy requirement (Supplemented)

Figure 5.Relative expression of progesterone receptor membrane component 1 (PGRMC1) in pituitary, follicular, and luteal tissues collected on Day 27 from female Boer goats receiving either a maintenance diet (Control) or short-term concentrate supplementation supplying twice the maintenance energy requirement (Supplemented)

Correlations between Hormone Concentration and Gene Expression

vance of these molecular adaptations. A moderate positive correlation was observed between PGRMC1 expression and plasma progesterone concentration (r = 0.65, p<0.05), indicating that increased PGRMC1 expression is associated with enhanced luteal progesterone output. LEPR expression also showed a moderate positive correlation with progesterone (r = 0.61, p<0.05), suggesting that leptin signaling contributes to luteal steroidogenesis.

Linear regression analysis (Figure 6) confirmed that expression of both genes significantly predicted progesterone concentration. PGRMC1 expression accounted for approximately 75% of the variation in progesterone levels (R² = 0.75), while LEPR expression explained about 57% (R² = 0.57). These findings underscore the importance of both leptin signaling and progesterone receptor-associated pathways as key mediators linking nutritional status to luteal function.

Figure 6.Relationships between plasma progesterone concentration and the relative expression of (A) PGRMC1 and (B) LEPR in luteal tissue collected from female Boer goats receiving either a maintenance diet or short-term concentrate supplementation supplying twice the maintenance energy requirement

DISCUSSION

The absence of a significant effect on ovulation rate suggests that the improved pregnancy outcomes were not due to increased ovulatory activity, but rather to post-ovulatory mechanisms. The combination of unchanged ovulation rate, higher pregnancy rate, and reduced embryonic loss indicates improved luteal function and endocrine support during early gestation. These findings suggest that nutritional supplementation may enhance embryo survival during early pregnancy rather than fertilisation success. This interpretation is consistent with previous reports linking early embryonic mortality to luteal insufficiency and inadequate progesterone secretion, which impair uterine receptivity and increase the risk of implantation failure or embryonic loss(Bustamante-Andrade et al., 2021). However, it should be noted that the relatively small sample size may limit the detection of subtle effects on ovulation rate, and thus minor treatment effects cannot be entirely excluded.

In contrast to earlier assumptions that increased dietary energy could elevate hepatic progesterone clearance and increase embryo losses in sheep (Viñoles et al., 2015), the present findings are consistent with studies in Australian Cashmere goats, where high-protein diets did not reduce progesterone concentrations despite elevated leptin and insulin (Shikh Maidin et al., 2014), and in pigs, where increased energy intake did not negatively affect embryonic survival in most experiments (Leal et al., 2019).

The observed endocrine changes are consistent with established leptin–NPY interactions linking nutrition and reproduction. Elevated leptin reflects improved energy balance and suppresses hypothalamic NPY expression, thereby relieving inhibition of GnRH neurons and facilitating LH secretion, a key driver of luteal progesterone synthesis (Takle & Legesse, 2017). Recent studies further demonstrate that improved nutritional status enhances leptin sensitivity, strengthening its inhibitory effect on NPY and reinforcing reproductive prioritization(Zhang et al., 2020); (Asgari et al., 2025). Although NPY is primarily recognized for its central role, increasing evidence indicates that it also acts peripherally within the ovary, where it can suppress steroidogenesis(Urata et al., 2020). Thus, the reduction in circulating NPY in supplemented does may contribute to a more favorable luteal environment by alleviating inhibitory effects on progesterone synthesis. Nevertheless, the present study did not directly assess hypothalamic or intra-ovarian NPY expression, and therefore, mechanistic inferences regarding central versus peripheral actions should be interpreted cautiously.

In addition to its central actions, leptin exerts direct ovarian effects. Leptin receptors are abundantly expressed in ovarian tissues, including the CL (Gallelli et al., 2019); (Macedo et al., 2019); (Martins et al., 2021), where leptin enhances the activity of key steroidogenic enzymes such as StAR, P450scc, and 3β-HSD (Chaudhari et al., 2020). During the luteal phase, elevated leptin concentrations may activate these local pathways, complementing leptin-induced stimulation of the hypothalamic–pituitary–gonadal axis. Recent evidence suggests that these central and peripheral mechanisms act synergistically under conditions of improved metabolic status, potentially leading to enhanced progesterone synthesis and luteal competence (Batista et al., 2013)

The upregulation of LEPR in luteal tissue suggests a dual mechanism whereby leptin acts both centrally and locally to enhance reproductive function. Locally, leptin signaling within the corpus luteum may promote angiogenesis, enhance steroidogenic enzyme activity, and support luteal cell survival. This interpretation is consistent with previous findings in goats demonstrating LEPR expression in luteal tissue and showing that leptin enhances expression of angiogenic factors such as VEGF, FGF2, and angiopoietin 1 in early luteal cultures, thereby supporting luteal vascularisation and functional maintenance (Garcia, 2017). Similar regulation of VEGF/FGF2/Ang1 by leptin is reported in caprine and porcine CL and summarized in a recent review (Flores et al., 2022); (Mlyczyńska et al., 2022).

Additionally, PGRMC1 is suggested to influence progesterone synthesis through non-genomic pathways that enhance steroidogenesis by increasing cholesterol synthesis. This occurs through two mechanisms: first, PGRMC1 directly binds to insulin-induced gene-1 (INSIG1) and sterol regulatory element-binding protein cleavage-activating protein (SCAP), increasing SCAP transcription, thereby enhancing steroid synthesis via StAR (Manna et al., 2016); (Stocco & Selvaraj, 2017). Second, PGRMC1 stabilizes the P450 protein CYP51/lanosterol demethylase (McGuire et al., 2021), thereby regulating intracellular cholesterol production, which serves as the precursor for progesterone biosynthesis(Asperger et al., 2020). Through these pathways, PGRMC1 facilitates the sustained production of progesterone, which is essential for embryo survivability. It should be noted, however, that gene expression data were not complemented by protein-level or functional assays, which would be required to confirm the activation of these pathways.

Furthermore, PGRMC1 is recognized as a mediator of progesterone action in follicles (Lodde et al., 2022). Progesterone inhibits follicular growth and granulosa cell mitosis, with substantial evidence supporting its anti-mitotic effects (Sueldo et al., 2015). Increased PGRMC1 expression in supplemented does may be associated with slower follicular development by suppressing intracellular signaling pathways such as p-ERK1/2, p-p38, and p-NF-κB, which are involved in cell differentiation and steroidogenesis (Yuan et al., 2019). This suppression of steroidogenic enzymes (StAR and cholesterol side-chain cleavage enzyme) may reduce oestradiol production, diminishing negative feedback on gonadotropin-releasing hormone (GnRH) secretion and thereby enhancing LH secretion. This increase in LH may further support CL function and progesterone production.

Overall, the combined endocrine, molecular, and reproductive data suggest that nutritional supplementation enhances reproductive performance primarily by improving luteal function rather than increasing ovulation rate. This effect is mediated through coordinated systemic changes in metabolic hormones and local upregulation of key genes involved in leptin signaling and progesterone synthesis. Nevertheless, the relatively small sample size, particularly for molecular and correlation analyses, may limit statistical power, and the observed associations should therefore be interpreted as indicative rather than definitive. Future research should focus on elucidating downstream signaling pathways associated with LEPR and PGRMC1 in the corpus luteum, particularly their interactions with steroidogenic acute regulatory protein (StAR) and mitochondrial cholesterol transport. Additionally, investigation of whether the benefits of nutritional supplementation extend into later gestation and influence offspring development would further clarify its long-term reproductive value.

CONCLUSION

Short-term nutritional supplementation improved progesterone levels and luteal function in goats during early pregnancy. This suggests that nutritional flushing helps create a better hormonal environment for supporting early embryo development. These findings highlight the importance of targeted nutrition during early gestation as a practical strategy to support reproductive success in goats.

CONFLICT OF INTEREST

The authors declare that there is no conflict of interest.

ACKNOWLEDGMENT

The authors wish to acknowledge and express their sincere gratitude to the Fundamental Research Grant Scheme (FRGS: 5524818-01-01-15-1713FR) awarded by the Malaysian Ministry of Higher Education.

DECLARATION OF GENERATIVE AI AND AI-ASSISTED TECHNOLOGIES IN THE WRITING PROCESS

During the preparation of this work, the authors used artificial intelligence tools to assist in drafting, editing, and improving the clarity of the manuscript. After using this tool, the authors critically reviewed and revised the content as needed and take full responsibility for the final content of the publication.

How to Cite

References

Asgari R., Caceres-Valdiviezo M., Wu S., Hamel L., Humber B.E., Agarwal S.M., Fletcher P.J., Fulton S., Hahn M.K., Pereira S.. Regulation of energy balance by leptin as an adiposity signal and modulator of the reward system. Molecular Metabolism. 2025; 91DOI
Asperger H., Stamm N., Gierke B., Pawlak M., Hofmann U., Zanger U.M., Marton A., Katona R.L., Buhala A., Vizler C., Cieslik J.-P., Ruckhäberle E., Niederacher D., Fehm T., Neubauer H., Ludescher M.. Progesterone receptor membrane component 1 regulates lipid homeostasis and drives oncogenic signaling resulting in breast cancer progression. Breast Cancer Research. 2020; 22:1-16. DOI
Astuti D.A., Khotijah L., Maidin M.S., Nugroho P.. Reproductive profile of Etawah crossbred does fed flushing diet containing different kinds of plant oil and animal fat. Pakistan Journal of Biological Sciences. 2020; 23(5):650-657. DOI
Batista A.M., Silva D.M.F., Rêgo M.J.B.M., Silva F.L.M., Silva E.C.B., Beltrão E.I.C., Gomes Filho M.A., Wischral A., Guerra M.M.P.. The expression and localization of leptin and its receptor in goat ovarian follicles. Animal Reproduction Science. 2013; 141(3-4):142-147. DOI
Bustamante-Andrade J.A., Meza-Herrera C.A., Rodríguez-Martínez R., Santos-Jimenez Z., Ángel-García O., Gaytán-Alemán L.R., Gutierrez-Guzman U.N., Esquivel-Romo A., Véliz-Deras F.G.. Luteogenesis and embryo implantation are enhanced by exogenous hCG in goats subjected to an out-of-season fixed-time artificial insemination protocol. Biology. 2021; 10(5)DOI
Celestino J.J.H., Bruno J.B., Lima-Verde I.B., Matos M.H.T., Saraiva M.V.A., Chaves R.N., Martins F.S., Almeida A.P., Cunha R.M.S., Lima L.F., Khesller P.O., Campello C.C., Silva J.R.V., Báo S.N., Figueiredo J.R.. Steady-state level of kit ligand mRNA in goat ovaries and the role of kit ligand in preantral follicle survival and growth in vitro. Molecular Reproduction and Development. 2010; 77(3):231-240. DOI
Chaudhari R.K., Mahla A.S., Singh S.K., Pawde A.M., Badasara S.K., Kumar H., Patra M.K., Krishnaswamy N.. Effect of dietary n-3 polyunsaturated fatty acid flushing on the expression of genes involved in progesterone biosynthesis in the corpus luteum of goat (Capra hircus. Reproduction in Domestic Animals. 2020; 55(9):1263-1266. DOI
Dar R.R., Firdous S., Amin B.Y., Ali A., Narayanan K., Patel M.. Luteal dysfunction: A potential cause of repeat breeding and the strategies to combat it. Theriogenology Insight. 2017; 7(2):105-112. DOI
Flores R., Ramirez M., Ayala L., Benavides E., Xie F., Arellano A., Stanko R., Garcia M.. Adiponectin influences FGF2 in the developing porcine corpus luteum. Veterinary Sciences. 2022; 9(2)DOI
Frota I.M.A., Leitão C.C.F., Costa J.J.N., Brito I.R., Hurk R., Silva J.R.V.. Stability of housekeeping genes and expression of locally produced growth factors and hormone receptors in goat preantral follicles. Zygote. 2011; 19(1):71-83. DOI
Gallelli M., Bianchi C., Lombardo D., Rey F., Rodriguez F., Castillo V., Miragaya M.. Leptin and IGF1 receptors in alpaca (Vicugna pacos) ovaries. Animal reproduction science. 2019; 200:96-104. DOI
Garcia M.R.. Leptin contributes to the development of the corpus luteum. Cell & developmental biology. 2017; 6(3)DOI
Köse A.M., Ürer E.K., Sarıbay M.K., Doğruer G., Karaka F., Çetin N.Ç., Demirezer H.. The effect of gonadotropin releasing hormone administration on fertility and embryonic loss in goats during the anoestrus period. Acta Scientiae Veterinariae. 2021; 49DOI
Leal D.F., Muro B.B., Nichi M., Almond G.W., Viana C.H., Vioti G., Carnevale R.F., Garbossa C.A.. Effects of post-insemination energy content of feed on embryonic survival in pigs: A systematic review. Animal Reproduction Science. 2019; 205:70-77. DOI
Lixiang F., Rongqian Z., Zhang K., Yang W.. Comparison of the 2-CT method and the 2-ΔΔCT method for real-time qPCR data analysis. Journal of Sichuan University. 2025. DOI
Lodde V., Garcia Barros R., Terzaghi L., Franciosi F., Luciano A.M.. Insights on the role of PGRMC1 in mitotic and meiotic cell division. Cancers. 2022; 14(23)DOI
Macedo T., Santos J., Bezerra M., Menezes V., Gouveia B., Barbosa L., Lins T., Monte A., Barberino R., Batista A., Barros V., Wischral A., Queiroz M., Araújo G., Matos M.. Immunolocalization of leptin and its receptor in the sheep ovary and in vitro effect of leptin on follicular development and oocyte maturation. Molecular and Cellular Endocrinology. 2019; 495DOI
Manna P.R., Stetson C.L., Slominski A.T., Pruitt K.. Role of the steroidogenic acute regulatory protein in health and disease. Endocrine. 2016; 51(1):7-21. DOI
Martin G.B.. Frontiers in sheep reproduction – Making use of natural responses to environmental challenges to manage productivity. Animal Reproduction. 2022; 19(4)DOI
Martins K., Haas C., Rovani M., Moreira F., Goetten A., Ferst J., Portela V., Duggavathi R., Bordignon V., Gonçalves P., Gasperin B., Lucia T.. Regulation and function of leptin during ovarian follicular development in cows. Animal reproduction science. 2021; 227DOI
McGuire M.R., Mukhopadhyay D., Myers S.L., Mosher E.P., Brookheart R.T., Kammers K., Sehgal A., Selen E.S., Wolfgang M.J., Bumpus N.N., Espenshade P.J.. Progesterone receptor membrane component 1 (PGRMC1) binds and stabilizes cytochromes P450 through a heme-independent mechanism. Journal of Biological Chemistry. 2021; 297(5)DOI
Meza-Herrera C.A., Santamaría-Estrada C.E., Flores-Hernández A., Cano-Villegas O., Peña C.G.D., Macías-Cruz U., Calderón-Leyva G., Ángel-García O., Mellado M., Carrillo-Moreno D., Véliz-Deras G.F.. The Opuntia effect upon the out-of-season embryo implantation rate in goats: Corpus luteal number, corpus luteal diameter and serum progesterone concentrations. Livestock Science. 2019; 228:201-206. DOI
Mlyczyńska E., Kieżun M., Kurowska P., Dawid M., Pich K., Respekta N., Daudon M., Rytelewska E., Dobrzyń K., Kamińska B., Kamiński T., Smolińska N., Dupont J., Rak A.. New aspects of corpus luteum regulation in physiological and pathological conditions: involvement of adipokines and neuropeptides. Cells. 2022; 11(6)DOI
Mohammed N.H., ShikhMaidin M., Yong C.S.Y., Ling K.H., Martin G.B.. Expression of progesterone receptor membrane component 1 (PGRMC1) in follicular and luteal tissues in goats – Effect of short-term concentrate supplementation. Tropical Animal Science Journal. 2025; 48(2):113-119. DOI
Nakano Y., Kashino C., Hasegawa T., Iwata N., Soejima Y., Suyama A., Otsuka F.. Effects of leptin and ghrelin on ovarian steroidogenesis and involvement of BMP action in rat granulosa cells. Journal of the Endocrine Society. 2022; 6(Supplement_1)DOI
Council National Research. Nutrient requirements of small ruminants: sheep, goats, cervids, and new world camelids. The National Academies Press. 2007; 384DOI
O’Connell A.R., Hurst P.R., Davis G.H., McNatty K.P., Taylor S.L., Juengel J.L.. An earlier rise in systemic progesterone and increased progesterone in the uterine vein during early pregnancy are associated with enhanced embryonic survival in the ewe. Theriogenology. 2013; 80(3):269-274. DOI
Robertson S.M., Atkinson T., Friend M.A., Allworth M.B., Refshauge G.. Reproductive performance in goats and causes of perinatal mortality: A review. Animal Production Science. 2020; 60(14):1669-1680. DOI
Samir H., Karen A., Ashmawy T., Abo-Ahmed M., El-Sayed M., Watanabe G.. Monitoring of embryonic and fetal losses in different breeds of goats using real-time B-mode ultrasonography. Theriogenology. 2016; 85(2):207-215. DOI
Shikh Maidin M., Blackberry M.A., Milton J.T.B., Hawken P.A.R., Martin G.B.. Nutritional supplements, leptin, insulin and progesterone in female Australian cashmere goats. APCBEE Procedia. 2014; 8:299-304. DOI
Solairaja S., Ramalingam S., Dunna N.R., Venkatabalasubramanian S.. Progesterone receptor membrane component 1 and its accomplice: Emerging therapeutic targets in lung cancer. Endocrine, Metabolic & Immune Disorders-Drug Targets. 2022; 22(6):601-611. DOI
Stocco D., Selvaraj V.. Yet another scenario in the regulation of the steroidogenic acute regulatory (STAR) protein gene. Endocrinology. 2017; 158(2):235-238. DOI
Sueldo C., Liu X., Peluso J.J.. Progestin and AdipoQ receptor 7, progesterone membrane receptor component 1 (PGRMC1), and PGRMC2 and their role in regulating progesterone’s ability to suppress human granulosa/luteal cells from entering into the cell cycle1. Biology of Reproduction. 2015; 93(3):1-11. DOI
Takle Z.J., Legesse T.G.. The effect of leptin on the hypothalamic-pituitary gonadal axis and puberty. International Journal of Health Sciences and Research. 2017; 7(5):332-344. Publisher Full Text
Urata Y., Salehi R., Lima P.D.A., Osuga Y., Tsang B.K.. Neuropeptide Y regulates proliferation and apoptosis in granulosa cells in a follicular stage-dependent manner. Journal of Ovarian Research. 2020; 13DOI
Urata Y., Salehi R., Wyse B.A., Jahangiri S., Librach C., Tzeng C.R., Osuga Y., Tsang B.K.. Neuropeptide Y directly reduced apoptosis of granulosa cells, and the expression of NPY and its receptors in PCOS subjects. Journal of Ovarian Research. 2023; 16DOI
Viñoles C., Sosa C., Meikle A., Abecia J.A.. Handbook of Fertility. Academic Press; 2015. DOI
Widiyono I., Yanuartono P., Purnamaningsih H., Sarmin S.. Influence of refeeding on production, blood biochemistry parameters, and reproduction in underfed Kacang goat does. Journal of Animal Physiology and Animal Nutrition. 2022; 107:453-462. DOI
Wittayarat M., Kupthammasan N., Jehdo H., Jintana R., Suttikrai S., Tongkumtae N., Chutijiratthitkan N., Khirilak P., Norsoongnern S., Kaewma S., Wattanachant C., Panyaboriban S.. Influence of hormonal treatments on progesterone levels to enhance embryo survival and kidding rates in goats. Animal Bioscience. 2024; 38(6):1140-1149. DOI
Yuan X., Yang C., Wang X., Zhang L., Gao X., Shi Z.. Progesterone maintains the status of granulosa cells and slows follicle development partly through PGRMC1. Journal of Cellular Physiology. 2019; 234:709-720. DOI
Zhang L., Reed F., Herzog H.. Leptin signalling on arcuate NPY neurones controls adiposity independent of energy balance or diet composition. Journal of Neuroendocrinology. 2020; 32(9)DOI
Zhang W., Peng J., Wang N., Shi Z., Wu J., Tong D.. Expression of leptin and its long-form receptor in the porcine corpus luteum during pregnancy and the protective role of leptin in corpus luteum function in vitro. Theriogenology. 2025; 242DOI

Copyright & License

This work is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License.Authors submitting manuscripts should understand and agree that copyright of manuscripts of the article shall be assigned/transferred to Tropical Animal Science Journal. The statement to release the copyright to Tropical Animal Science Journal is stated in Form A. This work is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License (CC BY-SA) where Authors and Readers can copy and redistribute the material in any medium or format, as well as remix, transform, and build upon the material for any purpose, but they must give appropriate credit (cite to the article or content), provide a link to the license, and indicate if changes were made. If you remix, transform, or build upon the material, you must distribute your contributions under the same license as the original.

Read Counter : 46 Download : 17

Share Now

[BIBR-1] Asgari R., Caceres-Valdiviezo M., Wu S., Hamel L., Humber B.E., Agarwal S.M., Fletcher P.J., Fulton S., Hahn M.K., Pereira S.. Regulation of energy balance by leptin as an adiposity signal and modulator of the reward system. Molecular Metabolism. 2025; 91DOI

[BIBR-2] Asperger H., Stamm N., Gierke B., Pawlak M., Hofmann U., Zanger U.M., Marton A., Katona R.L., Buhala A., Vizler C., Cieslik J.-P., Ruckhäberle E., Niederacher D., Fehm T., Neubauer H., Ludescher M.. Progesterone receptor membrane component 1 regulates lipid homeostasis and drives oncogenic signaling resulting in breast cancer progression. Breast Cancer Research. 2020; 22:1-16. DOI

[BIBR-3] Astuti D.A., Khotijah L., Maidin M.S., Nugroho P.. Reproductive profile of Etawah crossbred does fed flushing diet containing different kinds of plant oil and animal fat. Pakistan Journal of Biological Sciences. 2020; 23(5):650-657. DOI

[BIBR-4] Batista A.M., Silva D.M.F., Rêgo M.J.B.M., Silva F.L.M., Silva E.C.B., Beltrão E.I.C., Gomes Filho M.A., Wischral A., Guerra M.M.P.. The expression and localization of leptin and its receptor in goat ovarian follicles. Animal Reproduction Science. 2013; 141(3-4):142-147. DOI

[BIBR-5] Bustamante-Andrade J.A., Meza-Herrera C.A., Rodríguez-Martínez R., Santos-Jimenez Z., Ángel-García O., Gaytán-Alemán L.R., Gutierrez-Guzman U.N., Esquivel-Romo A., Véliz-Deras F.G.. Luteogenesis and embryo implantation are enhanced by exogenous hCG in goats subjected to an out-of-season fixed-time artificial insemination protocol. Biology. 2021; 10(5)DOI

[BIBR-6] Celestino J.J.H., Bruno J.B., Lima-Verde I.B., Matos M.H.T., Saraiva M.V.A., Chaves R.N., Martins F.S., Almeida A.P., Cunha R.M.S., Lima L.F., Khesller P.O., Campello C.C., Silva J.R.V., Báo S.N., Figueiredo J.R.. Steady-state level of kit ligand mRNA in goat ovaries and the role of kit ligand in preantral follicle survival and growth in vitro. Molecular Reproduction and Development. 2010; 77(3):231-240. DOI

[BIBR-7] Chaudhari R.K., Mahla A.S., Singh S.K., Pawde A.M., Badasara S.K., Kumar H., Patra M.K., Krishnaswamy N.. Effect of dietary n-3 polyunsaturated fatty acid flushing on the expression of genes involved in progesterone biosynthesis in the corpus luteum of goat (Capra hircus. Reproduction in Domestic Animals. 2020; 55(9):1263-1266. DOI

[BIBR-8] Dar R.R., Firdous S., Amin B.Y., Ali A., Narayanan K., Patel M.. Luteal dysfunction: A potential cause of repeat breeding and the strategies to combat it. Theriogenology Insight. 2017; 7(2):105-112. DOI

[BIBR-9] Flores R., Ramirez M., Ayala L., Benavides E., Xie F., Arellano A., Stanko R., Garcia M.. Adiponectin influences FGF2 in the developing porcine corpus luteum. Veterinary Sciences. 2022; 9(2)DOI

[BIBR-10] Frota I.M.A., Leitão C.C.F., Costa J.J.N., Brito I.R., Hurk R., Silva J.R.V.. Stability of housekeeping genes and expression of locally produced growth factors and hormone receptors in goat preantral follicles. Zygote. 2011; 19(1):71-83. DOI

[BIBR-11] Gallelli M., Bianchi C., Lombardo D., Rey F., Rodriguez F., Castillo V., Miragaya M.. Leptin and IGF1 receptors in alpaca (Vicugna pacos) ovaries. Animal reproduction science. 2019; 200:96-104. DOI

[BIBR-12] Garcia M.R.. Leptin contributes to the development of the corpus luteum. Cell & developmental biology. 2017; 6(3)DOI

[BIBR-13] Köse A.M., Ürer E.K., Sarıbay M.K., Doğruer G., Karaka F., Çetin N.Ç., Demirezer H.. The effect of gonadotropin releasing hormone administration on fertility and embryonic loss in goats during the anoestrus period. Acta Scientiae Veterinariae. 2021; 49DOI

[BIBR-14] Leal D.F., Muro B.B., Nichi M., Almond G.W., Viana C.H., Vioti G., Carnevale R.F., Garbossa C.A.. Effects of post-insemination energy content of feed on embryonic survival in pigs: A systematic review. Animal Reproduction Science. 2019; 205:70-77. DOI

[BIBR-15] Lixiang F., Rongqian Z., Zhang K., Yang W.. Comparison of the 2-CT method and the 2-ΔΔCT method for real-time qPCR data analysis. Journal of Sichuan University. 2025. DOI

[BIBR-16] Lodde V., Garcia Barros R., Terzaghi L., Franciosi F., Luciano A.M.. Insights on the role of PGRMC1 in mitotic and meiotic cell division. Cancers. 2022; 14(23)DOI

[BIBR-17] Macedo T., Santos J., Bezerra M., Menezes V., Gouveia B., Barbosa L., Lins T., Monte A., Barberino R., Batista A., Barros V., Wischral A., Queiroz M., Araújo G., Matos M.. Immunolocalization of leptin and its receptor in the sheep ovary and in vitro effect of leptin on follicular development and oocyte maturation. Molecular and Cellular Endocrinology. 2019; 495DOI

[BIBR-18] Manna P.R., Stetson C.L., Slominski A.T., Pruitt K.. Role of the steroidogenic acute regulatory protein in health and disease. Endocrine. 2016; 51(1):7-21. DOI

[BIBR-19] Martin G.B.. Frontiers in sheep reproduction – Making use of natural responses to environmental challenges to manage productivity. Animal Reproduction. 2022; 19(4)DOI

[BIBR-20] Martins K., Haas C., Rovani M., Moreira F., Goetten A., Ferst J., Portela V., Duggavathi R., Bordignon V., Gonçalves P., Gasperin B., Lucia T.. Regulation and function of leptin during ovarian follicular development in cows. Animal reproduction science. 2021; 227DOI

[BIBR-21] McGuire M.R., Mukhopadhyay D., Myers S.L., Mosher E.P., Brookheart R.T., Kammers K., Sehgal A., Selen E.S., Wolfgang M.J., Bumpus N.N., Espenshade P.J.. Progesterone receptor membrane component 1 (PGRMC1) binds and stabilizes cytochromes P450 through a heme-independent mechanism. Journal of Biological Chemistry. 2021; 297(5)DOI

[BIBR-22] Meza-Herrera C.A., Santamaría-Estrada C.E., Flores-Hernández A., Cano-Villegas O., Peña C.G.D., Macías-Cruz U., Calderón-Leyva G., Ángel-García O., Mellado M., Carrillo-Moreno D., Véliz-Deras G.F.. The Opuntia effect upon the out-of-season embryo implantation rate in goats: Corpus luteal number, corpus luteal diameter and serum progesterone concentrations. Livestock Science. 2019; 228:201-206. DOI

[BIBR-23] Mlyczyńska E., Kieżun M., Kurowska P., Dawid M., Pich K., Respekta N., Daudon M., Rytelewska E., Dobrzyń K., Kamińska B., Kamiński T., Smolińska N., Dupont J., Rak A.. New aspects of corpus luteum regulation in physiological and pathological conditions: involvement of adipokines and neuropeptides. Cells. 2022; 11(6)DOI

[BIBR-24] Mohammed N.H., ShikhMaidin M., Yong C.S.Y., Ling K.H., Martin G.B.. Expression of progesterone receptor membrane component 1 (PGRMC1) in follicular and luteal tissues in goats – Effect of short-term concentrate supplementation. Tropical Animal Science Journal. 2025; 48(2):113-119. DOI

[BIBR-25] Nakano Y., Kashino C., Hasegawa T., Iwata N., Soejima Y., Suyama A., Otsuka F.. Effects of leptin and ghrelin on ovarian steroidogenesis and involvement of BMP action in rat granulosa cells. Journal of the Endocrine Society. 2022; 6(Supplement_1)DOI

[BIBR-26] Council National Research. Nutrient requirements of small ruminants: sheep, goats, cervids, and new world camelids. The National Academies Press. 2007; 384DOI

[BIBR-27] O’Connell A.R., Hurst P.R., Davis G.H., McNatty K.P., Taylor S.L., Juengel J.L.. An earlier rise in systemic progesterone and increased progesterone in the uterine vein during early pregnancy are associated with enhanced embryonic survival in the ewe. Theriogenology. 2013; 80(3):269-274. DOI

[BIBR-28] Robertson S.M., Atkinson T., Friend M.A., Allworth M.B., Refshauge G.. Reproductive performance in goats and causes of perinatal mortality: A review. Animal Production Science. 2020; 60(14):1669-1680. DOI

[BIBR-29] Samir H., Karen A., Ashmawy T., Abo-Ahmed M., El-Sayed M., Watanabe G.. Monitoring of embryonic and fetal losses in different breeds of goats using real-time B-mode ultrasonography. Theriogenology. 2016; 85(2):207-215. DOI

[BIBR-30] Shikh Maidin M., Blackberry M.A., Milton J.T.B., Hawken P.A.R., Martin G.B.. Nutritional supplements, leptin, insulin and progesterone in female Australian cashmere goats. APCBEE Procedia. 2014; 8:299-304. DOI

[BIBR-31] Solairaja S., Ramalingam S., Dunna N.R., Venkatabalasubramanian S.. Progesterone receptor membrane component 1 and its accomplice: Emerging therapeutic targets in lung cancer. Endocrine, Metabolic & Immune Disorders-Drug Targets. 2022; 22(6):601-611. DOI

[BIBR-32] Stocco D., Selvaraj V.. Yet another scenario in the regulation of the steroidogenic acute regulatory (STAR) protein gene. Endocrinology. 2017; 158(2):235-238. DOI

[BIBR-33] Sueldo C., Liu X., Peluso J.J.. Progestin and AdipoQ receptor 7, progesterone membrane receptor component 1 (PGRMC1), and PGRMC2 and their role in regulating progesterone’s ability to suppress human granulosa/luteal cells from entering into the cell cycle1. Biology of Reproduction. 2015; 93(3):1-11. DOI

[BIBR-34] Takle Z.J., Legesse T.G.. The effect of leptin on the hypothalamic-pituitary gonadal axis and puberty. International Journal of Health Sciences and Research. 2017; 7(5):332-344. Publisher Full Text

[BIBR-35] Urata Y., Salehi R., Lima P.D.A., Osuga Y., Tsang B.K.. Neuropeptide Y regulates proliferation and apoptosis in granulosa cells in a follicular stage-dependent manner. Journal of Ovarian Research. 2020; 13DOI

[BIBR-36] Urata Y., Salehi R., Wyse B.A., Jahangiri S., Librach C., Tzeng C.R., Osuga Y., Tsang B.K.. Neuropeptide Y directly reduced apoptosis of granulosa cells, and the expression of NPY and its receptors in PCOS subjects. Journal of Ovarian Research. 2023; 16DOI

[BIBR-37] Viñoles C., Sosa C., Meikle A., Abecia J.A.. Handbook of Fertility. Academic Press; 2015. DOI

[BIBR-38] Widiyono I., Yanuartono P., Purnamaningsih H., Sarmin S.. Influence of refeeding on production, blood biochemistry parameters, and reproduction in underfed Kacang goat does. Journal of Animal Physiology and Animal Nutrition. 2022; 107:453-462. DOI

[BIBR-39] Wittayarat M., Kupthammasan N., Jehdo H., Jintana R., Suttikrai S., Tongkumtae N., Chutijiratthitkan N., Khirilak P., Norsoongnern S., Kaewma S., Wattanachant C., Panyaboriban S.. Influence of hormonal treatments on progesterone levels to enhance embryo survival and kidding rates in goats. Animal Bioscience. 2024; 38(6):1140-1149. DOI

[BIBR-40] Yuan X., Yang C., Wang X., Zhang L., Gao X., Shi Z.. Progesterone maintains the status of granulosa cells and slows follicle development partly through PGRMC1. Journal of Cellular Physiology. 2019; 234:709-720. DOI

[BIBR-41] Zhang L., Reed F., Herzog H.. Leptin signalling on arcuate NPY neurones controls adiposity independent of energy balance or diet composition. Journal of Neuroendocrinology. 2020; 32(9)DOI

[BIBR-42] Zhang W., Peng J., Wang N., Shi Z., Wu J., Tong D.. Expression of leptin and its long-form receptor in the porcine corpus luteum during pregnancy and the protective role of leptin in corpus luteum function in vitro. Theriogenology. 2025; 242DOI

Article Sidebar

Abstract

Full text article

References

Authors

Article Details

How to Cite

Most read articles by the same author(s)