2615-790XTropical Animal Science JournalTrop. Anim. Sci. J.2615-790X2615-787XFaculty of Animal Science, IPB UniversityIndonesia10.5398/tasj.2026.49.4.372Increased Occurrence of Antimicrobial Resistance and Virulence Genes in Escherichia coli from Broilers in the Central Highlands of Vietnamhttps://orcid.org/0009-0003-8115-0456PhuongH. T. A.Viet Namhtaphuong@ttn.edu.vnhttps://orcid.org/0009-0006-9306-6464YenL. T. H.Viet Namhttps://orcid.org/0009-0002-6183-5071HaiL. D.Viet NamWiryawanProf. Dr. Komang GIndonesiaDepartment of Veterinary MedicineTay Nguyen Universityhttps://ror.org/01s7bde64VietnamDepartment of Research and Development, UV Joint Stock Company 749900, VietnamTropical Animal Science Journal
We certify that there is no conflict of interest with any financial, personal, or other relationships with other people or organizations related to the material discussed in the manuscript.
Corresponding author: H. T. A. Phuong, Department of Veterinary Medicine, Tay Nguyen University. Email: htaphuong@ttn.edu.vn362026362026494Tropical Animal Science Journal37238018220263042026852026Copyright (c) 2026 Tropical Animal Science Journal2026Tropical Animal Science Journalhttp://creativecommons.org/licenses/by-sa/4.0/This work is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License.Authors submitting manuscripts should understand and agree that copyright of manuscripts of the article shall be assigned/transferred to Tropical Animal Science Journal. The statement to release the copyright to Tropical Animal Science Journal is stated in Form A. This work is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License (CC BY-SA) where Authors and Readers can copy and redistribute the material in any medium or format, as well as remix, transform, and build upon the material for any purpose, but they must give appropriate credit (cite to the article or content), provide a link to the license, and indicate if changes were made. If you remix, transform, or build upon the material, you must distribute your contributions under the same license as the original.Increased Occurrence of Antimicrobial Resistance and Virulence Genes in Escherichia coli from Broilers in the Central Highlands of Vietnam
Antimicrobial resistance is becoming a major concern for the poultry industry, particularly as Escherichia coli strains are increasingly exhibiting multidrug resistance. This study aims to assess the antimicrobial resistance and virulence genes of E. coli isolated from broilers in the Central Highlands of Vietnam, providing a scientific basis for managing antimicrobial use in poultry production. A total of 370 rectal fecal samples were collected from 25 farms, including 250 samples from healthy broilers (67.6%) and 120 samples from diarrheal broilers (32.4%). E. coli isolates were identified using conventional biochemical methods and confirmed by 16S rRNA gene sequencing. In addition, isolates from diarrheal samples (n=120) were screened for seven virulence genes (hlyE, iss, eaeA, ent, escV, stx1, and stx2) using PCR. Data were statistically analyzed using R (version 4.4.1) to determine the prevalence of antimicrobial resistance, multidrug resistance (MDR), virulence genes, and AMR/MDR profiles. The results showed high resistance rates to most tested antimicrobial agents, particularly tetracycline and erythromycin (>90%), while ciprofloxacin exhibited the lowest resistance rate (31%–32%). The proportions of isolates resistant to at least one antimicrobial agent and those classified as MDR were 97.5% and 90.3%, respectively. Among the isolates from diarrheal samples, 94.2% carried at least one virulence gene. The genes hlyE, iss, and stx2 were the most prevalent, whereas ent, eaeA, and escV were detected at lower frequencies, and stx1 was not detected (p<0.001). The high prevalence of multidrug resistance, together with the frequent detection of hlyE, iss, and stx2 suggests the co-occurrence of resistance and virulence traits, which may facilitate their dissemination within the intestinal microbiota.
antimicrobial agentsbroilerdiarrheamultidrug resistanceFile created by JATS EditorJATS Editorissue-created-year2026INTRODUCTION
Escherichia coli is a Gram-negative bacterium belonging to the family Enterobacteriaceae, commonly present in the intestinal microbiota of poultry and plays an important role in the balance of the intestinal ecosystem(Ribeiro et al., 2023). Although most E. coli strains are normal flora, some strains carry specific virulence factors capable of causing intestinal or systemic diseases, classified as Avian Pathogenic E. coli (APEC)(Hu et al., 2022). These strains can cause diarrhea, enteritis, air sacculitis, sepsis, reduced weight gain, and increased mortality, especially in intensive farming systems with high density and short production cycles such as broilers(Nordin et al., 2021).
Pathogenic E. coli is of global particular concern not only because of its ability to cause disease in poultry, but also because of its genetic diversity and ability to carry virulence genes related to adhesion (eaeA), invasion (escV), enterotoxin (stx), hemolysin (hlyE), or serum survival (iss) genes(LeStrange et al., 2017). The simultaneous presence of multiple virulence genes is often associated with stronger pathogenicity, higher transmission potential, and a greater risk of causing severe intestinal mucosal damage(Rogers et al., 2023). In particular, broilers’ diarrhea is one of the important clinical symptoms reflecting an imbalance in the intestinal microflora, invasion of pathogenic microorganisms, or digestive disorders related to nutrition, farming environment, and management(Mora et al., 2020);(Wickramasuriya et al., 2022). In addition to its pathogenicity, multidrug resistance (MDR) of E. coli strains isolated from poultry is becoming a major challenge for veterinary and public health. The prolonged use of antimicrobials for disease prevention, treatment, or growth promotion in poultry production systems has created strong selection pressure, promoting the spread of E. coli strains resistant to multiple groups of antimicrobial agents(Arbab et al., 2022);(Abreu et al., 2023). Plasmids carrying MDR genes can be transferred horizontally between bacteria of the same or different species, forming a reservoir of drug-resistant genes in the livestock environment(Rodríguez-Beltrán et al., 2021);(Dimitriu, 2022).
In Vietnam, the broiler industry has developed strongly in recent years. However, intensive farming conditions, high stocking density, the circulation of various pathogens, and the abuse of antimicrobials have contributed to the increase in E. coli infection levels and the risk of emerging MDR strains(Liang et al., 2021);(Nhung et al., 2022). However, findings of E. coli strains carrying virulence genes associated with multidrug resistance remain limited, hindering a comprehensive assessment of the prevalence risk of pathogenic and antimicrobial-resistant E. coli strains. Furthermore, although the Vietnamese government has banned the use of antimicrobials for prevention and growth promotion in poultry production since 2026, there is still a lack of comprehensive regulatory frameworks governing antimicrobial use in practice(Vietnam-Government, 2020). In the Central Highlands of Vietnam, where the agricultural economy is mainly based on poultry production, the limited regulatory controls of antimicrobial use, together with expanding intensive poultry production systems, may facilitate antimicrobial misuse and accelerate the emergence and spread of antimicrobial-resistant microorganisms, highlighting the need for regional surveillance studies.
Therefore, it is necessary to conduct this study to evaluate the levels of antimicrobial resistance and the distribution of virulence genes (hlyE, iss, eaeA, ent, escV, stx1, and stx2) in E. coli isolates from broilers in the Central Highlands of Vietnam. We hypothesize that E. coli isolates from broilers, particularly those from diarrheal chickens, exhibit a high prevalence of multidrug resistance and harbor multiple virulence genes, with a potential co-occurrence of resistance and virulence traits.
MATERIALS AND METHODSSample Collection
All procedures involving sample collection from broilers were conducted in accordance with the guidelines approved by the Animal Ethics Advisory Committee of Vietnam (Approval No: HUVN0059, 2025). The study took place from March to August, 2025. A total of 370 fecal samples from broiler rectum were collected from 25 broiler farms in three wards (Ea Kao, Khanh Xuan, and Cu Ebua) in Dak Lak Province, including 250 samples from healthy broilers and 120 samples from broilers with diarrhea (defined as loose or watery feces). After collection, the samples were placed into sterile plastic bags labeled with sample information and stored in a cold box (4–8 °C) and transported to the laboratory for analysis within 4 hours.
Isolation of <italic>Escherichia coli</italic>
Bacteria were isolated using standard culture and biochemical identification methods(Vietnam-Standard, 2011);(Nhung et al., 2022). Each fecal sample yielded one representative E. coli isolate (one isolate per sample), resulting in a total of 370 isolates corresponding to 370 samples.
In brief, approximately 1 g of each fecal sample was enriched in Buffered Peptone Water (BPW, Oxoid, UK) at 37 oC for 24h. A sterile cotton swab was used to streak the enrichment onto MacConkey agar (Oxoid, UK) and incubated at 37 °C for 24 h. A single typical lactose-fermenting colony (pink) was selected and streaked onto Eosin Methylene Blue (EMB, Oxoid, UK) agar, followed by incubation at 37 °C for 24 h. Colonies showing metallic green sheen were selected and purified by subculturing on Nutrient Agar (NA, Oxoid, UK) for further analysis and storage.
For Gram staining, the bacteria were Gram-negative rods, non-spore-forming, and stained pink with safranin. Biochemical identification included IMViC (+, +, −, −), TSI (A/A, gas +, H₂S −), KIA (A/A, gas +, H₂S −), Urea broth (−), and LIA (alkaline/alkaline, H₂S −) (Oxoid, UK). E. coli ATCC 25922 was used as a quality control strain. All presumptive isolates were further confirmed by 16S rRNA gene sequencing(Li et al., 2024).
Determination of Virulence Genes
Only E. coli isolates obtained from diarrheal samples (n=120) were screened for virulence genes using PCR (Table 1)(Wang et al., 2010);(Sun et al., 2011);(Bako et al., 2017). In brief, (1) isolates were cultured on Luria-Bertani agar (LB, Oxoid, UK) at 37 oC for 24 h; (2) DNA template was prepared by boiling method, a single colony was suspended in 50–100 µL nuclease-free water, heated at 100 oC for 10 minutes, and centrifuged; (3) PCR reaction mixture (20 µL total volume) included Master Mix Phu Sa 2X (10 µL), forward primer (1 µL), reverse primer (1 µL), nuclease-free water (6 µL), and DNA template (2 µL); (4) PCR amplification was performed with initial denaturation at 95 °C for 1 min, followed by 30 cycles of 95 °C for 30 s, annealing at 54–59 °C for 30 s (depending on primer), 72 °C for 1 min, and a final extension at 72 °C for 5 min (Table 1); (5) PCR products were analyzed by electrophoresis on 1.5% agarose gel prepared in 1X TAE buffer, stained and visualized under UV light. A 100 bp DNA ladder was used as a molecular marker (Figure 1).
Primer sequences, product sizes, and annealing temperatures used for PCR detection of Escherichia coli and virulence genes isolated from diarrheic broilers
Strain
Gene
Primer sequence (5’-3’)
Amplicon size (bp)
Annealing temperature
Source
Escherichia coli
E16S
F- ATCAACCGAGATTCCCCCAGT
R- TCACTATCGGTCAGTCAGGAG
231bp
58 ᵒC
Sun et al. (2011)(Sun et al., 2011)
APEC
hlyE
F- ACGCCCGCAGCAATAGAATA
R- AAAGCATCCGCCCAGAAAGA
283 bp
58 ᵒC
Wang et al. (2010)(Wang et al., 2010)
iss
F- AACCGACAGCAGTAACAC
R- TAGGGAGCCCAGAAGTA
274 bp
54 ᵒC
EPEC
eaeA
F- GACCCGGCACAAGCATAAGC
R- CCACCTGCAGCAACAAGAGG
384 bp
59 ᵒC
Bako et al. (2017)(Bako et al., 2017)
escV
F- GGCTCTCTTCTTCTTTATGGCTG
R- CCTTTTACAAACTTCATCGCC
534 bp
55 ᵒC
ent
F- TGGGCTAAAAGAAGACACACTG
R- CAAGCATCCTGATTATCTCACC
629 bp
55 ᵒC
STEC
stx1
F- ATAAATCGCCATTCGTTGACTAC
R- AGAACGCCCACTGAGATCATC
180 bp
56 ᵒC
stx2
F- GGCACTGTCTGAAACTGCTCC
R- TCGCCAGTTATCTGACATTCTG
255 bp
57 ᵒC
Amplified PCR products of the agarose gel electrophoresis process of Escherichia coli isolated from diarrheic broilers. N: negative control, M: DNA marker (gene ladder 100-bp), Other lanes: tested isolates.
ImageDetermination of Drug Resistance Phenotype
Antimicrobial susceptibility was determined using the Kirby–Bauer disk diffusion method. Briefly, Mueller-Hinton agar (MH, Oxoid, UK) plates were inoculated with E. coli isolates titrated at 0.5 McFarland standard (~1.5 × 10⁸ CFU/mL). Antimicrobial disks were placed on the agar surface and incubated at 37 °C for 16–18 h. All tests were performed in triplicate, and inhibition zone diameters were measured and interpreted as susceptible (S), intermediate (I), or resistant (R) according to Clinical and Laboratory Standards Institute(C.L.S.I., 2023). A total of 11 antimicrobials representing 8 classes were tested including tetracyclines (tetracycline 30 µg), penicillins (ampicillin 10 µg), aminoglycosides (streptomycin 10 µg, gentamicin 10 µg, kanamycin 30 µg), folate pathway antogonists (trimethoprim-sulfamethoxazole 1.25/23.75 µg), quinolones and fluoroquinolones (ciprofloxacin 5 µg, enrofloxacin 5 µg), macrolides (erythromycin 15 µg), cephems (cefotaxime 30 µg), and β-lactam combination agents (amoxicillin-clavulanate 20/10 µg). MDR was defined as resistance to at least one agent in three or more antimicrobial classes(Magiorakos et al., 2012).
Statistic Analysis
Data were analyzed using R language software (version 4.4.1). Categorical variables such as fecal conditions, positive/negative results, and drug resistance status were standardized to a binary form. Positive rates were calculated using the Wilson method with 95% confidence intervals. Differences between groups (region, fecal conditions, virulence genes, etc.) were assessed using the Chi-square or Fisher’s exact test. Pairwise comparisons were performed using the proportion test (prop.test or Fisher), and p-values were adjusted using the Benjamini–Hochberg method to control for multiple testing bias. Antimicrobial resistance (AMR), multidrug resistance (MDR), virulence gene rates, and AMR/MDR profiles were summarized and visualized using bar charts and heatmaps to describe the distribution trends, antimicrobial resistance, and virulence levels between groups. Results are reported with sample size (n/N), proportions (%), 95% CI, and corresponding p-values or adjusted p-values (p_adj), where applicable.
RESULTSPrevalence and Multidrug Resistance of <bold><italic>E. coli</italic></bold><bold> in Areas</bold>
Of the total 370 rectal fecal samples of broilers collected at farms in the three areas of Ea Kao, Khanh Xuan and Cu Ebua, Dak Lak Province, 360/370 samples were positive for E. coli (97.3%, 95% CI: 95.1%–98.6%) (Table 2). The results showed that the prevalence of E. coli in diarrheal samples was 120/120 (100%, 95% CI: 97.0%–100%), which was significantly higher than in healthy samples (240/250; 96%, 95% CI: 92.7%–97.9%) (p=0.03). The prevalence in Ea Kao, Khanh Xuan, and Cu Ebua was 95.8% (95% CI: 89.7%–98.4%), 96% (95% CI: 88.9%–98.6%), and 96.2% (95% CI: 89.5%–98.7%), respectively, with no statistically significant differences between areas (p>0.05). The overall multidrug resistance (MDR) rate was 325/360 (90.3%, 95% CI: 86.7%–93.1%), with no significant difference between areas (X²=2.267; df=2; p=0.322).
Prevalence of Escherichia coli and multidrug resistance (MDR) isolates from diarrheic and normal broilers in different sampling locations
Isolates
Sampling location
Total
Ea Kao
Khanh Xuan
Cu Ebua
Diarrheal fecal samples
No. of samples
50
35
35
120
No. of isolates positive
50
35
35
120
% of isolates positive
100
100
100
100ᵃ
Normal fecal samples
No. of samples
95
75
80
250
No. of isolates positive
91
72
77
240
% of isolates positive
95.8
96
96.2
96ᵇ
MDR (n=360)
No. of MDR isolates
128
93
104
325
% of MDR isolates
90.8
86.9
92.9
90.3
Note: a,b Different letters within a column are statistically significant
Resistance rates were high for most antimicrobials tested across the three areas (Figure 2). In Eakao, resistance rates were >80% for tetracycline, ampicillin, streptomycin, gentamicin, enrofloxacin, erythromycin, and amoxicillin-clavulanate. In Khanh Xuan, this pattern was observed for tetracycline, ampicillin, streptomycin, and erythromycin (>80%), while in Cu Ebua, high resistance was observed for tetracycline, ampicillin, streptomycin, enrofloxacin, and erythromycin. The results showed that resistance rates were highest for tetracycline and erythromycin (>90%), and exceeded 50% for most antimicrobials tested. The lowest resistance rate was recorded for ciprofloxacin (31%–32%) (Table 3). Susceptibility rates ranged from 0.6% to 28.3%, with the lowest for erythromycin and the highest for gentamicin (23.6%) and trimethoprim-sulfamethoxazole (28.3%) (Table 3).
Image
Escherichia coli resistance towards the tested antimicrobials
Antimicrobial agents
Resistance status (%)
Resistant (%)
Intermediate (%)
Susceptible (%)
Tetracycline
93.3
4.7
1.9
Ampicillin
87.5
11.1
1.4
Streptomycin
87.8
6.4
5.8
Gentamicin
74.2
2.2
23.6
Kanamycin
72.2
12.8
15.0
Trimethoprim-sulfamethoxazole
65.8
5.8
28.3
Ciprofloxacin
31.4
55.5
13.1
Enrofloxacin
81.9
10.6
7.5
Erythromycin
94.4
5.0
0.6
Cefotaxime
61.4
22.2
16.4
Amoxicillin-clavulanate
71.9
19.7
8.3
Multidrug Resistance Profiles of <italic>E. coli</italic> Isolates
A total of 325/360 isolates (90.3%, 95% CI: 86.7%–93.1%) exhibited multidrug resistance (MDR). It was found that the most common MDR phenotypes were TET-AMP-STR-GEN-KAN-SXT-CIP-ENO-ERY-CTX-AMC (27.3%), TET-AMP-STR-GEN-KAN-SXT-ENO-ERY-CTX-AMC (14.1%), while other MDR patterns were observed at frequencies <6% (Figure 3).
ImagePrevalence of Virulence Genes and Virulence Profiles of <italic>E. coli</italic>
Among isolates from diarrheal samples (n=120), the most prevalent virulence genes were hlyE (93.3%), iss (54.2%), and stx2 (31.7%). In contrast, ent, eaeA, and escV were detected at low frequencies (1.7%–3.3%), and stx1 was not detected (0%) (Table 4). The differences in gene prevalence were statistically significant (p<0.001). The occurrence of hlyE and iss genes was significantly higher than expected (standardized residuals – SR: +17.8, +7.3), while eaeA, ent, escV, and stx1 were significantly lower (SR: from –6.2 to –7.1). Pairwise comparisons with Benjamini–Hochberg (BH adjusted) indicated that most gene pairs differed significantly (p_adj<0.05), confirming a heterogeneous distribution of virulence genes.
Distribution of virulence genes among Escherichia coli isolated from diarrheic broilers (n=120)
Virulence gene
Positive isolates
Virulence isolates (%)
hlyE
112
93.3
iss
65
54.2
ent
2
1.7
eaeA
3
2.5
escV
4
3.3
stx1
0
0
stx2
38
31.7
Of the 120 isolates, 113/120 (94.2%, 95% CI: 88.6%–97.3%) carried at least one virulence gene, while 7/120 (5.8%) carried none (p<0.001). The most common virulence profiles were hlyE alone (29.2%), hlyE-iss (31.7%), hlyE-iss-stx2 (18.3%), and hlyE-stx2 (7.5%), whereas other combinations were observed at frequencies <3% (Figure 4).
Virulence gene profile of Escherichia coli isolated from diarrheic broilers
ImageDISCUSSION
This study showed that the antimicrobial resistance of E. coli isolated from diarrheal stool samples of broilers was at a high level. High resistance rates were found in most of the tested antimicrobials, indicating a concerning pattern of resistance in intensive poultry production systems. The antimicrobials tested in this study were based on the list of drugs permitted for use in animal production in Vietnam and antimicrobials sold at local veterinary drug stores. Overall, the findings indicate widespread antimicrobial resistance and multidrug resistance (MDR) in the surveyed poultry farms. The frequent and repeated use of antimicrobials in treatment may contribute to the selection of resistant strains(Molia et al., 2025).
One important mechanism explaining this phenomenon is the selective pressure exerted by prolonged antimicrobial use in animal husbandry, which facilitates the survival and spread of antimicrobial-resistant bacterial strains within the gut microbiota. Additionally, many antimicrobial resistance genes are often located on plasmids or mobile genetic elements, allowing them to be transferred horizontally between different microorganisms, thereby accelerating the dissemination of resistance within microbial populations(Pitout & Chen, 2023).
In this study, high resistance rates (>70%) were observed for tetracycline, ampicillin, streptomycin, enrofloxacin, and erythromycin, while most other antimicrobials also showed resistance rates above 50%. A previous study in southern Vietnam reported high resistance rates of E. coli to gentamicin (42.2%), ciprofloxacin (73.3%), and ampicillin (97.8%)(Nguyen et al., 2016). Another recent study in southern Vietnam also reported high resistance rates to amoxicillin (68.8%), doxycycline (75.9%), and oxytetracycline (77.2%)(Nhung et al., 2022). These findings are consistent with reports from other countries, such as resistance to ampicillin (99.4%), intermediate resistance to enrofloxacin (92%)(Bhattarai et al., 2024), resistance to erythromycin (91.8%), and tetracycline (100%)(Roy et al., 2025).
High resistance to tetracycline and ampicillin may be related to their widespread overuse in poultry husbandry, leading to strong selective pressure on bacteria carrying resistance genes such as tet and bla. These genes are often located on plasmids or integrons, allowing them to spread rapidly within the bacterial population and create MDR(Roy et al., 2025). Additionally, co-selection can occur when multiple different resistance genes coexist on a single plasmid, meaning that the use of one antimicrobial may simultaneously maintain resistance to others(Bhattarai et al., 2024).
In this study, the proportion of isolates resistant to at least one antimicrobial agent was very high (97.5%). This result is comparable to a previous study in Vietnam from 2017 to 2019, where the rate reached 99%(Tuat et al., 2021). A recent study also reported that 96.7% of E. coli isolates carried at least one AMR gene(Laopiem et al., 2025).
Although ciprofloxacin showed the lowest resistance rate (31%–32%), the high intermediate proportion is also a concern, indicating an increasing resistance trend. Similar increasing trends in fluoroquinolone resistance have been reported in other countries(Garcia & Zavala-Cerna, 2024);(Ruiz-Lievano et al., 2024).
The emergence of fluoroquinolone resistance may be associated with mutations in the gyrA and parC genes, leading to structural changes in the DNA gyrase and topoisomerase IV, which are the primary targets of fluoroquinolones. Additionally, mechanisms such as efflux pumps or reduced membrane permeability may also contribute to decreased antimicrobial efficacy(Ruiz-Lievano et al., 2024).
The susceptibility rates observed in this study were generally low (0.6%–28.3%). Erythromycin showed the lowest susceptibility (0.6%), while gentamicin and trimethoprim–sulfamethoxazole showed relatively higher values (23.6% and 28.3%, respectively), although these levels remain limited in clinical relevance. These findings suggest that the selection of effective antimicrobials for treating E. coli-associated diarrhea in broilers is increasingly challenging and requires continuous monitoring and reassessment of treatment strategies(Ribeiro et al., 2023).
Regarding MDR, the study recorded a high prevalence (>90%). A previous study showed that the MDR rate of 89% in Vietnam during 2017–2019(Tuat et al., 2021). Similar trends have been reported in other countries, indicating substantial antimicrobial selection pressure in intensive livestock systems(Zhou et al., 2022);(Tongkamsai et al., 2024). In the current study, the most common MDR phenotypes involved resistance to 9–11 antimicrobial agents, reflecting complex resistance patterns.
The increasing complexity of MDR phenotypes may result from the accumulation of multiple resistance genes on plasmids or integrons, facilitating horizontal gene transfer between bacterial strains. This is particularly relevant in high-density farming systems, where bacteria can rapidly exchange genetic material and disseminate resistance traits within the gut microbiota(Tongkamsai et al., 2024).
In this study, E. coli isolates showed a high prevalence of virulence genes, particularly hlyE, iss, and stx2, while ent, eaeA, and escV were detected at low frequencies, and stx1 was not detected. This is consistent with a recent study in Vietnam, which reported a higher prevalence of stx2 (90.5%) compared to stx1 (9.5%)(Duc et al., 2024).
The co-occurrence of virulence and antimicrobial resistance genes may reflect genetic linkage, as many plasmids or pathogenicity islands can carry both types of determinants(Zhou et al., 2022). Such co-occurrence may enhance bacterial fitness under antimicrobial pressure while also contributing to pathogenic potential(Duc et al., 2024).
The current study showed a high prevalence of virulence genes in isolates from diarrheal broilers (p<0.001). This is consistent with the known pathogenic mechanisms of APEC and strains carrying stx2 or genes related to adhesion and invasion(Castro et al., 2025);(Nederveen & Melton-Celsa, 2025).
Furthermore, the association between resistance phenotypes and the presence of certain virulence genes may indicate that pathogenic strains may harbor multiple adaptive traits that support persistence in poultry production systems(Castro et al., 2025). This underscores the importance of simultaneously monitoring resistance and virulence determinants in epidemiological studies of E. coli.
The findings of the study provide additional evidence on the coexistence of antimicrobial resistance and virulence traits in E. coli and contribute to a better understanding of their potential role in diarrheal conditions in broilers. These results may support the development of improved disease management strategies and antimicrobial stewardship in poultry production, particularly in Vietnam.
CONCLUSION
This study showed a high prevalence of antimi-crobial resistance and multidrug-resistant phenotypes of E. coli isolates. The common prevalence of hlyE, iss, and stx2 was found in diarrheal fecal samples. These findings revealed the circulation of potentially resistant and pathogenic E. coli strains in broiler production systems. The study provides important baseline data for antimicrobial resistance surveillance and supports the development of more effective antimicrobial steward-ship strategies in poultry production.
ACKNOWLEDGEMENT
The study was funded by the Department of Research and Development, UV Joint Stock Company, Vietnam, in collaboration with Tay Nguyen University, in order to support local research in the Central Highlands of Vietnam.
DECLARATION OF GENERATIVE AI AND AI-ASSISTED TECHNOLOGIES IN THE WRITING PROCESS
Authors declare that the use of generative AI and AI-assisted technologies in the writing process is only to improve the readability and language of the work.
REFERENCESAntimicrobial drug resistance in poultry production: Current status and innovative strategies for bacterial controlMicroorganisms114AbreuR.Semedo-LemsaddekT.CunhaE.TavaresL.OliveiraM.202395310.3390/microorganisms11040953Antimicrobial drug resistance against Escherichia coli and its harmful effect on animal healthVeterinary Medicine and Science84ArbabS.UllahH.WangW.ZhangJ.2022178017861780-178610.1002/vms3.825Characterization of diarrheagenic Escherichia coli isolated in organic waste products (Cattle fecal matter, manure and, slurry) from cattle’s markets in Ouagadougou, Burkina FasoInternational Journal of Environmental Research and Public Health1410BakoE.KagambègaA.TraoreK.A.BagreT.S.IbrahimH.B.BoudaS.C.BonkoungouI.J.O.KaboréS.ZongoC.TraoreA.S.BarroN.201710.3390/ijerph14101100Antimicrobial resistance of avian pathogenic Escherichia coli isolated from broiler, layer, and breeder chickensVeterinary World172BhattaraiR.K.BasnetH.B.DhakalI.P.DevkotaB.202448010.14202/vetworld.2024.480-499Genomic mapping of Brazilian Escherichia coli: Characterizing Shiga toxin-producing, enteropathogenic, and diffusely adherent strains using an in silico approachBacteria44CastroV.S.BumunangE.W.StanfordK.FigueiredoE.E.D.S.20255510.3390/bacteria4040055Performance standards for antimicrobial susceptibility testingC.L.S.I.2023Clinical and Laboratory Standards Institute33rdEvolution of horizontal transmission in antimicrobial resistance plasmidsMicrobiology1687DimitriuT.2022001214Website linkPrevalence, molecular characterization, and antimicrobial resistance profiles of Shiga toxin-producing Escherichia coli isolated from raw beef, pork, and chicken meat in VietnamFoods1313DucH.M.HaC.T.T.HoaT.T.K.HungL.V.ThangN.V.SonH.M.202410.3390/foods13132059Fluoroquinolone resistance in Escherichia coli causing community-acquired urinary tract infections: A systematic reviewMicroorganisms1211GarciaL.F.Zavala-CernaM.G.2024232010.3390/microorganisms12112320Characteristics, pathogenic mechanism, zoonotic potential, drug resistance, and prevention of avian pathogenic Escherichia coli (APECFrontiers in Microbiology13HuJ.AfayiboD.J.A.ZhangB.ZhuH.YaoL.GuoW.WangX.WangZ.WangD.PengH.TianM.QiJ.WangS.2022104939110.3389/fmicb.2022.1049391Antimicrobial resistance, virulence gene profiles, and phylogenetic groups of Escherichia coli isolated from healthy broilers and broilers with colibacillosis in ThailandBMC Veterinary Research211LaopiemS.WitoonsatianK.KulprasetsriS.PanomwanP.Pathomchai-UmpornC.KamtaeR.JirawattanapongP.SongsermT.SinwatN.202516010.1186/s12917-025-04626-xAn evaluation of the virulence and adherence properties of avian pathogenic Escherichia coliOne Health4LeStrangeK.MarklandS.M.HooverD.G.SharmaM.KnielK.E.2017222622-2610.1016/j.onehlt.2017.08.00116S rRNA gene sequencing for bacterial identification and infectious disease diagnosisBiochemical and Biophysical Research Communications739LiM.N.HanQ.WangN.WangT.YouX.M.ZhangS.ZhangC.C.ShiY.Q.QiaoP.Z.ManC.L.FengT.LiY.Y.ZhuZ.QuanK.J.XuT.L.ZhangG.F.202415097410.1016/j.bbrc.2024.150974Effects of Taraxacum and Astragalus extracts combined with probiotic Bacillus subtilis and Lactobacillus on Escherichia coli–infected broiler chickensPoultry Science1004LiangW.H.LiZhouH.WangM.ZhaoX.SunX.LiC.ZhangX.202110100710.1016/j.psj.2021.01.030Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistanceClinical Microbiology and Infection183MagiorakosA.P.SrinivasanA.CareyR.B.CarmeliY.FalagasM.E.GiskeC.G.HarbarthS.HindlerJ.F.KahlmeterG.Olsson-LiljequistB.PatersonD.L.RiceL.B.StellingJ.StruelensM.J.VatopoulosA.WeberJ.T.MonnetD.L.2012268281268-28110.1111/j.1469-0691.2011.03570.xAntibiotic resistance and antibiotic use in companion animal veterinary medicine: A qualitative study in Southwestern FranceSSM-Qualitative Research in Health8MoliaS.MatternJ.FortanéN.202510063210.1016/j.ssmqr.2025.100632Clostridium perfringens as foodborne pathogen in broiler production: pathophysiology and potential strategies for controlling necrotic enteritisAnimals109MoraZ.V.D.L.Macías-RodríguezM.E.Arratia-QuijadaJ.Gonzalez-TorresY.S.NuñoK.Villarruel-LópezA.2020171810.3390/ani10091718Use of colistin and other critical antimicrobials on pig and chicken farms in southern Vietnam and its association with resistance in commensal Escherichia coli bacteriaApplied and Environmental Microbiology8213NguyenN.T.NguyenH.M.NguyenC.V.NguyenT.V.NguyenM.T.ThaiH.Q.HoM.H.ThwaitesG.NgoH.T.BakerS.Carrique-MasJ.2016372737353727-373510.1128/AEM.00337-16Antimicrobial resistance in commensal Escherichia coli from humans and chickens in the Mekong Delta of Vietnam is driven by antimicrobial usage and potential cross-species transmissionJAC-Antimicrobial Resistance43NhungN.T.YenN.T.P.DungN.T.T.NhanN.T.M.PhuD.H.KietB.T.ThwaitesG.GeskusR.B.BakerS.Carrique-MasJ.ChoisyM.202205410.1093/jacamr/dlac054High prevalence of antimicrobial resistance in commensal Escherichia coli from poultry in VietnamJournal of Global Antimicrobial Resistance29NhungN.T.CuongN.V.CampbellJ.HoaN.T.BryantJ.E.Carrique-MasJ.2022369376369-37610.1016/j.jgar.2022.03.018Infectious bronchitis associated with Escherichia coli infection in commercial broiler chickens: a case reportJournal of Advanced Veterinary and Animal Research81NordinN.SaniN.I.M.KadirA.A.ShaariR.MohamedM.ReduanM.F.H.NordinM.L.202110110.5455/javar.2021.h491The significance of epidemic plasmids in the success of multidrug-resistant drug pandemic extraintestinal pathogenic Escherichia coliInfectious Diseases and Therapy124PitoutJ.D.ChenL.2023102910411029-104110.1007/s40121-023-00791-4Antibiotic resistance among gastrointestinal bacteria in broilers: A review focused on Enterococcus sppand Escherichia coli. Animals138RibeiroJ.SilvaV.MonteiroA.Vieira-PintoM.IgrejasG.ReisF.S.BarrosL.PoetaP.2023136210.3390/ani13081362Beyond horizontal gene transfer: the role of plasmids in bacterial evolutionNature Reviews Microbiology196Rodríguez-BeltránJ.DelaFuenteJ.Leon-SampedroR.MacLeanR.C.San MillanA.2021347359347-35910.1038/s41579-020-00497-1Impact of enteric bacterial infections at and beyond the epithelial barrierNature Reviews Microbiology214RogersA.P.MiletoS.J.LyrasD.2023260274260-27410.1038/s41579-022-00794-xPrevalence and antimicrobial resistance patterns of Escherichia coli isolated from broiler chickens in Sylhet district of BangladeshVeterinary Medicine and Science115RoyM.IslamO.RahmanM.A.MistyS.S.KurmiR.IslamM.A.RaquibA.TipuJ.H.HossainM.A.IslamM.S.20257057610.1002/vms3.70576Fluoroquinolone resistance in Escherichia coli causing community-acquired urinary tract infections: A systematic reviewMicroorganisms1211Ruiz-LievanoA.P.Cervantes-FloresF.Nava-TorresA.Carbajal-MoralesP.J.Villaseñor-GarciaL.F.Zavala-CernaM.G.2024232010.3390/microorganisms12112320Development of a multiplex PCR for diagnosis of Staphylococcus aureus, Escherichia coli and Bacillus cereus from cows with endometritisAgricultural Sciences in China1010SunD.B.RuiW.U.J.H.E.X.ShuangW.A.N.G.LinY.C.XuH.A.N.Yue-qiangW.Ting-tingG.Guo-junW.YangK.L.2011162416291624-162910.1016/S1671-2927(11)60160-0Multidrug-resistance in Escherichia coli and Klebsiella pneumoniae isolated from broiler chickens in Eastern ThailandThai Journal of Veterinary Medicine543TongkamsaiS.ChatmonteeW.NakbubpaK.2024161-610.56808/2985-1130.3668Antimicrobial resistance pilot surveillance of pigs and chickens in Vietnam, 2017–2019Frontiers in Veterinary Science8TuatC.V.HueP.T.LoanN.T.P.ThuyN.T.HueL.T.GiangV.N.EricksonV.I.PadungtodP.202161849710.3389/fvets.2021.618497Enteroaggregative Escherichia coli (EAECEcoSal Plus131NederveenV.Melton-CelsaA.R.2025-0011-202410.1128/ecosalplus.esp-0011-2024Decree guiding the Law on Animal HusbandryVietnam-Government2020Retrieved May 5, 2025, from01Animal diseases - diagnostic procedures - part 16: swine edema disease caused by E. coliVietnam-Standard2011Retrieved May 5, 2025, fromNong nghiepDistribution of serotypes and virulence-associated genes in pathogenic Escherichia coli isolated from ducksAvian Pathology394WangY.TangC.YuX.XiaM.YueH.2010297302297-30210.1080/03079457.2010.495742Role of physiology, immunity, microbiota, and infectious diseases in the gut health of poultryVaccines102WickramasuriyaS.S.ParkI.LeeK.LeeY.KimW.H.NamH.LillehojH.S.202217210.3390/vaccines10020172Antimicrobial resistance and genomic characterization of Escherichia coli from pigs and chickens in Zhejiang, ChinaFrontiers in Microbiology13ZhouW.R.LinZhouZ.MaJ.LinH.ZhengX.WangJ.WuJ.DongY.JiangH.YangH.YangZ.TangB.YueM.2022101868210.3389/fmicb.2022.1018682